Incidental Mutation 'R5794:Kctd10'
ID447115
Institutional Source Beutler Lab
Gene Symbol Kctd10
Ensembl Gene ENSMUSG00000001098
Gene Namepotassium channel tetramerisation domain containing 10
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114363567-114380508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114367337 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 199 (R199W)
Ref Sequence ENSEMBL: ENSMUSP00000099641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001125] [ENSMUST00000102581] [ENSMUST00000124316] [ENSMUST00000134532] [ENSMUST00000169347] [ENSMUST00000202006] [ENSMUST00000199567] [ENSMUST00000196467] [ENSMUST00000196676]
Predicted Effect probably damaging
Transcript: ENSMUST00000001125
AA Change: R200W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001125
Gene: ENSMUSG00000001098
AA Change: R200W

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 3.21e-19 SMART
low complexity region 287 303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102581
AA Change: R199W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099641
Gene: ENSMUSG00000001098
AA Change: R199W

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 6.89e-19 SMART
low complexity region 286 302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123538
Predicted Effect probably benign
Transcript: ENSMUST00000124316
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134173
Predicted Effect probably benign
Transcript: ENSMUST00000134532
SMART Domains Protein: ENSMUSP00000138564
Gene: ENSMUSG00000001098

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:BTB_2 34 89 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152694
Predicted Effect probably benign
Transcript: ENSMUST00000169347
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197773
Predicted Effect probably benign
Transcript: ENSMUST00000202006
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199567
SMART Domains Protein: ENSMUSP00000144492
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 213 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196467
SMART Domains Protein: ENSMUSP00000144133
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Blast:MYSc 1 52 7e-10 BLAST
Pfam:Myosin_TH1 70 181 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196676
SMART Domains Protein: ENSMUSP00000144682
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 204 7.3e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds proliferating cell nuclear antigen (PCNA) and may be involved in DNA synthesis and cell proliferation. In addition, the encoded protein may be a tumor suppressor. Several protein-coding and non-protein coding transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E10.5 and E11.5, abnormal vasculature, absent vitelline circulation, enlarged pericardium, thin myocardium and defective heart valve defect formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Kctd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kctd10 APN 5 114367349 missense probably damaging 1.00
IGL00832:Kctd10 APN 5 114368936 splice site probably null
R1666:Kctd10 UTSW 5 114368990 missense probably benign 0.01
R2137:Kctd10 UTSW 5 114367328 missense probably damaging 1.00
R2223:Kctd10 UTSW 5 114367349 missense probably benign 0.26
R3037:Kctd10 UTSW 5 114375000 missense probably damaging 1.00
R3522:Kctd10 UTSW 5 114374923 missense probably damaging 1.00
R5390:Kctd10 UTSW 5 114365703 missense possibly damaging 0.56
R5903:Kctd10 UTSW 5 114380462 unclassified probably benign
R6938:Kctd10 UTSW 5 114370130 nonsense probably null
R8119:Kctd10 UTSW 5 114367255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTGAATCCGGCCAGATTG -3'
(R):5'- TCAGGGGCTCACTTTCAGTAG -3'

Sequencing Primer
(F):5'- GTAGGAAGTGCCCCCATTTC -3'
(R):5'- GGGCTCACTTTCAGTAGAGATAG -3'
Posted On2016-12-15