Incidental Mutation 'R5794:Gnb2'
ID447116
Institutional Source Beutler Lab
Gene Symbol Gnb2
Ensembl Gene ENSMUSG00000029713
Gene Nameguanine nucleotide binding protein (G protein), beta 2
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137528127-137533510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137528699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000132908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031726] [ENSMUST00000031727] [ENSMUST00000111020] [ENSMUST00000111023] [ENSMUST00000111027] [ENSMUST00000111038] [ENSMUST00000132525] [ENSMUST00000140139] [ENSMUST00000143495] [ENSMUST00000150063] [ENSMUST00000168746] [ENSMUST00000170293]
Predicted Effect probably benign
Transcript: ENSMUST00000031726
AA Change: D303G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031726
Gene: ENSMUSG00000029713
AA Change: D303G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031727
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111020
AA Change: D259G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106649
Gene: ENSMUSG00000029713
AA Change: D259G

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111023
AA Change: D259G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106652
Gene: ENSMUSG00000029713
AA Change: D259G

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111027
AA Change: D345G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106656
Gene: ENSMUSG00000029713
AA Change: D345G

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
WD40 86 125 1.05e-7 SMART
WD40 128 167 3.96e-3 SMART
WD40 174 212 1.57e-6 SMART
WD40 215 254 2.98e-7 SMART
WD40 257 296 2.1e-7 SMART
WD40 299 340 1.72e-3 SMART
WD40 343 382 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125868
Predicted Effect probably benign
Transcript: ENSMUST00000132525
SMART Domains Protein: ENSMUSP00000119725
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140139
SMART Domains Protein: ENSMUSP00000121942
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142252
Predicted Effect probably benign
Transcript: ENSMUST00000143495
AA Change: D203G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126823
Gene: ENSMUSG00000029713
AA Change: D203G

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150063
AA Change: D303G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129353
Gene: ENSMUSG00000029713
AA Change: D303G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167225
Predicted Effect probably benign
Transcript: ENSMUST00000168746
AA Change: D203G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132908
Gene: ENSMUSG00000029713
AA Change: D203G

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170293
AA Change: D259G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128038
Gene: ENSMUSG00000029713
AA Change: D259G

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144667
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Gnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gnb2 APN 5 137530706 intron probably benign
ruffian UTSW 5 137530182 critical splice donor site probably null
R2336:Gnb2 UTSW 5 137529198 missense probably damaging 1.00
R4661:Gnb2 UTSW 5 137530253 start codon destroyed probably null 0.30
R5023:Gnb2 UTSW 5 137529940 unclassified probably null
R5395:Gnb2 UTSW 5 137528526 missense probably damaging 1.00
R5465:Gnb2 UTSW 5 137528513 missense probably damaging 1.00
R5633:Gnb2 UTSW 5 137529192 missense probably benign 0.12
R7107:Gnb2 UTSW 5 137530182 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGATCTTGAGGAAGGAGTC -3'
(R):5'- CAGTTCTTCCCCAATGGCTATG -3'

Sequencing Primer
(F):5'- AGTCCCAGGAGCCTGTAG -3'
(R):5'- TATGCCTTCACCACGGGATCAG -3'
Posted On2016-12-15