Incidental Mutation 'R5794:Klrc1'
ID447117
Institutional Source Beutler Lab
Gene Symbol Klrc1
Ensembl Gene ENSMUSG00000030167
Gene Namekiller cell lectin-like receptor subfamily C, member 1
SynonymsNKG2A, NKG2B, CD159a
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129666015-129678973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129675354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 188 (R188Q)
Ref Sequence ENSEMBL: ENSMUSP00000032271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032270] [ENSMUST00000032271] [ENSMUST00000118447] [ENSMUST00000169545]
Predicted Effect probably damaging
Transcript: ENSMUST00000032270
AA Change: R188Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032270
Gene: ENSMUSG00000030167
AA Change: R188Q

DomainStartEndE-ValueType
transmembrane domain 71 93 N/A INTRINSIC
CLECT 128 239 7.33e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032271
AA Change: R188Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032271
Gene: ENSMUSG00000030167
AA Change: R188Q

DomainStartEndE-ValueType
transmembrane domain 71 93 N/A INTRINSIC
CLECT 128 239 7.33e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118447
AA Change: R171Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114017
Gene: ENSMUSG00000030167
AA Change: R171Q

DomainStartEndE-ValueType
transmembrane domain 71 93 N/A INTRINSIC
CLECT 111 222 7.33e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169545
AA Change: R154Q

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130762
Gene: ENSMUSG00000030167
AA Change: R154Q

DomainStartEndE-ValueType
CLECT 94 205 7.33e-18 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Klrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Klrc1 APN 6 129678902 missense probably damaging 0.96
IGL02814:Klrc1 APN 6 129678892 missense possibly damaging 0.92
R3414:Klrc1 UTSW 6 129677763 critical splice donor site probably null
R4796:Klrc1 UTSW 6 129677762 splice site probably null
R5940:Klrc1 UTSW 6 129674935 missense possibly damaging 0.84
R7203:Klrc1 UTSW 6 129677221 missense probably benign 0.02
X0018:Klrc1 UTSW 6 129678799 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTCTTCAGAGTCACATGAGCAG -3'
(R):5'- ACACGCATATGTGAATGTTTTGGC -3'

Sequencing Primer
(F):5'- TTCAGAGTCACATGAGCAGACCATG -3'
(R):5'- GGCAATGTAAGAAGTGTTCTCTC -3'
Posted On2016-12-15