Incidental Mutation 'R5794:Clasrp'
ID447118
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene NameCLK4-associating serine/arginine rich protein
SynonymsSrsf16, Sfrs16, SWAP2
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19581035-19604486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19591109 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 198 (D198E)
Ref Sequence ENSEMBL: ENSMUSP00000147103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
Predicted Effect probably damaging
Transcript: ENSMUST00000086041
AA Change: D198E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: D198E

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207325
Predicted Effect unknown
Transcript: ENSMUST00000207524
AA Change: D198E
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect probably damaging
Transcript: ENSMUST00000207907
AA Change: D198E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208068
AA Change: D198E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19603254 missense probably damaging 1.00
clarissa UTSW 7 19590248 missense possibly damaging 0.82
suet UTSW 7 19586468 utr 3 prime probably benign
R0518:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0519:Clasrp UTSW 7 19584164 utr 3 prime probably benign
R0521:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0626:Clasrp UTSW 7 19584493 utr 3 prime probably benign
R0826:Clasrp UTSW 7 19584301 utr 3 prime probably benign
R1918:Clasrp UTSW 7 19585263 nonsense probably null
R2044:Clasrp UTSW 7 19586715 utr 3 prime probably benign
R2256:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2257:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2940:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3408:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3691:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4168:Clasrp UTSW 7 19581154 unclassified probably benign
R4496:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4505:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4507:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4572:Clasrp UTSW 7 19584464 splice site probably null
R4753:Clasrp UTSW 7 19594940 missense probably damaging 1.00
R4871:Clasrp UTSW 7 19590248 missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19584778 splice site probably null
R5538:Clasrp UTSW 7 19584782 utr 3 prime probably benign
R5582:Clasrp UTSW 7 19586856 missense probably damaging 0.97
R5615:Clasrp UTSW 7 19586447 utr 3 prime probably benign
R5944:Clasrp UTSW 7 19594506 missense probably damaging 1.00
R6102:Clasrp UTSW 7 19586468 utr 3 prime probably benign
R6171:Clasrp UTSW 7 19584822 splice site probably benign
R6485:Clasrp UTSW 7 19586369 utr 3 prime probably benign
R6600:Clasrp UTSW 7 19590282 nonsense probably null
R7383:Clasrp UTSW 7 19585273 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCTAGAACAGTGCCCAGAAATG -3'
(R):5'- ATGTGTAACCACTGTGGGGC -3'

Sequencing Primer
(F):5'- CACATGGGATAGGGGACAGGC -3'
(R):5'- TAACCACTGTGGGGCTCACC -3'
Posted On2016-12-15