Incidental Mutation 'R5794:Klk1b4'
ID447119
Institutional Source Beutler Lab
Gene Symbol Klk1b4
Ensembl Gene ENSMUSG00000066513
Gene Namekallikrein 1-related pepidase b4
SynonymsNgfa, mGk-4, Ngfa
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44207435-44211754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44209645 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 29 (N29I)
Ref Sequence ENSEMBL: ENSMUSP00000076576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077354]
PDB Structure
CRYSTAL STRUCTURE OF 7S NGF: A COMPLEX OF NERVE GROWTH FACTOR WITH FOUR BINDING PROTEINS (SERINE PROTEINASES) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000077354
AA Change: N29I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076576
Gene: ENSMUSG00000066513
AA Change: N29I

DomainStartEndE-ValueType
Tryp_SPc 10 248 5.88e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206046
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Klk1b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Klk1b4 APN 7 44211032 splice site probably benign
IGL00572:Klk1b4 APN 7 44210774 missense possibly damaging 0.79
IGL01314:Klk1b4 APN 7 44211176 critical splice donor site probably null
IGL02252:Klk1b4 APN 7 44210670 nonsense probably null
IGL03006:Klk1b4 APN 7 44211595 missense probably benign 0.08
R0255:Klk1b4 UTSW 7 44210734 missense probably benign 0.00
R0277:Klk1b4 UTSW 7 44211629 missense possibly damaging 0.78
R0931:Klk1b4 UTSW 7 44211056 missense probably damaging 1.00
R1718:Klk1b4 UTSW 7 44209672 missense probably damaging 1.00
R1777:Klk1b4 UTSW 7 44207451 start gained probably benign
R1894:Klk1b4 UTSW 7 44209630 missense probably benign
R1924:Klk1b4 UTSW 7 44209681 missense probably benign 0.00
R3979:Klk1b4 UTSW 7 44211593 missense probably damaging 1.00
R4044:Klk1b4 UTSW 7 44210755 missense probably benign 0.03
R5011:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R5013:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R7122:Klk1b4 UTSW 7 44211107 missense probably damaging 1.00
R7192:Klk1b4 UTSW 7 44209621 missense probably benign 0.44
R7595:Klk1b4 UTSW 7 44210708 missense probably benign
R8318:Klk1b4 UTSW 7 44210911 missense possibly damaging 0.92
R8331:Klk1b4 UTSW 7 44211575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATTGATCTCCCTATCGAG -3'
(R):5'- AGTTTCAGCCAGTTCCACCTG -3'

Sequencing Primer
(F):5'- CTATCGAGGACCAGCCATATATG -3'
(R):5'- GCCCTTCAGTACCCCAGC -3'
Posted On2016-12-15