Incidental Mutation 'R5794:Thap12'
ID447121
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene NameTHAP domain containing 12
SynonymsPrkrir, Dap4, 2900052B10Rik
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98703103-98718062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98716393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 589 (D589E)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: D589E

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: D589E

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTTTGGTTTGAGGAAGCCAC -3'
(R):5'- AGGGCTTCATAAATGGTGGAC -3'

Sequencing Primer
(F):5'- TGGTTTGAGGAAGCCACAAATTTAGC -3'
(R):5'- GACGGGAGCTCGATATCTTTCC -3'
Posted On2016-12-15