Incidental Mutation 'R5794:Aftph'
ID447128
Institutional Source Beutler Lab
Gene Symbol Aftph
Ensembl Gene ENSMUSG00000049659
Gene Nameaftiphilin
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location20685084-20741589 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 20726955 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035350] [ENSMUST00000146722] [ENSMUST00000177014] [ENSMUST00000177543]
Predicted Effect probably benign
Transcript: ENSMUST00000035350
AA Change: E218G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036778
Gene: ENSMUSG00000049659
AA Change: E218G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 1.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120008
Predicted Effect probably benign
Transcript: ENSMUST00000146722
AA Change: E218G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121612
Gene: ENSMUSG00000049659
AA Change: E218G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 694 765 1.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176782
SMART Domains Protein: ENSMUSP00000134791
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177014
AA Change: E63G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135450
Gene: ENSMUSG00000049659
AA Change: E63G

DomainStartEndE-ValueType
low complexity region 391 405 N/A INTRINSIC
low complexity region 463 476 N/A INTRINSIC
Pfam:Clathrin_bdg 538 610 6.8e-37 PFAM
low complexity region 664 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177543
AA Change: E218G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134991
Gene: ENSMUSG00000049659
AA Change: E218G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 8.7e-37 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Aftph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Aftph APN 11 20727483 missense probably damaging 1.00
IGL01485:Aftph APN 11 20692507 missense probably damaging 1.00
IGL01622:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01623:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01739:Aftph APN 11 20726994 missense probably damaging 0.98
IGL01777:Aftph APN 11 20726554 missense possibly damaging 0.49
IGL01825:Aftph APN 11 20726569 missense possibly damaging 0.77
IGL02804:Aftph APN 11 20726107 missense possibly damaging 0.89
IGL03003:Aftph APN 11 20726982 nonsense probably null
IGL03111:Aftph APN 11 20726040 missense probably benign 0.44
R1103:Aftph UTSW 11 20726547 missense probably benign 0.00
R1672:Aftph UTSW 11 20726762 missense probably benign 0.10
R2060:Aftph UTSW 11 20692571 missense probably damaging 1.00
R2141:Aftph UTSW 11 20698318 nonsense probably null
R2241:Aftph UTSW 11 20726328 missense possibly damaging 0.90
R2513:Aftph UTSW 11 20708676 splice site probably null
R2518:Aftph UTSW 11 20725797 missense probably damaging 0.98
R4751:Aftph UTSW 11 20727074 missense probably damaging 1.00
R4844:Aftph UTSW 11 20708667 splice site probably benign
R4879:Aftph UTSW 11 20698311 critical splice donor site probably null
R4895:Aftph UTSW 11 20696801 missense probably damaging 1.00
R5012:Aftph UTSW 11 20698264 intron probably benign
R5082:Aftph UTSW 11 20727100 missense probably damaging 0.98
R5093:Aftph UTSW 11 20709619 critical splice donor site probably null
R5160:Aftph UTSW 11 20712197 missense probably benign 0.03
R5288:Aftph UTSW 11 20726994 missense probably damaging 0.98
R5338:Aftph UTSW 11 20727203 missense probably benign 0.18
R6747:Aftph UTSW 11 20726144 splice site probably null
R6876:Aftph UTSW 11 20709744 missense probably damaging 1.00
R7034:Aftph UTSW 11 20692498 missense probably damaging 1.00
R7284:Aftph UTSW 11 20726812 missense probably benign 0.00
R7371:Aftph UTSW 11 20726836 missense probably benign
R8290:Aftph UTSW 11 20725712 missense probably benign 0.01
X0028:Aftph UTSW 11 20726338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGCAGACCTGATGTTCTC -3'
(R):5'- GTTCACCAAACCAAGCAGTTAG -3'

Sequencing Primer
(F):5'- AGTGTTCCCCGTATCCTCAAAG -3'
(R):5'- CCAAGCAGTTAGAGAGCTGC -3'
Posted On2016-12-15