Incidental Mutation 'R5794:Irgm1'
ID447129
Institutional Source Beutler Lab
Gene Symbol Irgm1
Ensembl Gene ENSMUSG00000046879
Gene Nameimmunity-related GTPase family M member 1
SynonymsIfi1, LRG-47, Irgm, Iigp3
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48861968-48871683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48866237 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 249 (Y249C)
Ref Sequence ENSEMBL: ENSMUSP00000094870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049519] [ENSMUST00000097271]
Predicted Effect probably damaging
Transcript: ENSMUST00000049519
AA Change: Y265C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050446
Gene: ENSMUSG00000046879
AA Change: Y265C

DomainStartEndE-ValueType
Pfam:IIGP 42 399 5.5e-169 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097271
AA Change: Y249C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094870
Gene: ENSMUSG00000046879
AA Change: Y249C

DomainStartEndE-ValueType
Pfam:IIGP 26 288 2.5e-131 PFAM
Pfam:MMR_HSR1 62 175 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147151
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection and bacterial infection is impaired in homozygous mutant mice, whereas resistance to viral infection is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Irgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Irgm1 APN 11 48866005 nonsense probably null
IGL01821:Irgm1 APN 11 48866526 missense probably damaging 1.00
IGL02043:Irgm1 APN 11 48866815 missense probably damaging 0.98
IGL02252:Irgm1 APN 11 48866154 missense possibly damaging 0.92
IGL03153:Irgm1 APN 11 48866267 missense probably damaging 1.00
igraine UTSW 11 48866613 missense probably benign 0.33
R0487:Irgm1 UTSW 11 48866327 missense probably damaging 0.98
R1808:Irgm1 UTSW 11 48866432 missense probably damaging 0.99
R1809:Irgm1 UTSW 11 48866613 missense probably benign 0.33
R1878:Irgm1 UTSW 11 48866070 missense probably benign 0.07
R2971:Irgm1 UTSW 11 48866590 nonsense probably null
R4492:Irgm1 UTSW 11 48866128 synonymous silent
R4962:Irgm1 UTSW 11 48866332 missense possibly damaging 0.93
R5186:Irgm1 UTSW 11 48866217 missense probably benign 0.00
R6224:Irgm1 UTSW 11 48866886 missense probably benign 0.02
R6487:Irgm1 UTSW 11 48865950 missense probably benign 0.21
R6752:Irgm1 UTSW 11 48866463 missense probably damaging 1.00
R6766:Irgm1 UTSW 11 48866101 missense possibly damaging 0.80
R8005:Irgm1 UTSW 11 48866390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTACTGTCCCCATACTCTGG -3'
(R):5'- CTCAGCACCAGTGTCCTATCAG -3'

Sequencing Primer
(F):5'- GGGCTACCTGCTGAACTGATTC -3'
(R):5'- ACCAGTGTCCTATCAGAGGTC -3'
Posted On2016-12-15