Mutagenetix > Incidental Mutations

Incidental Mutation 'R5794:Gprc5c'

447132

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

043385-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5794 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114864267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 257 (V257L)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Meta Mutation Damage Score

0.1280

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aftph	T	C	11: 20,726,955		probably null	Het
Ank2	T	C	3: 126,930,020	N923S	probably benign	Het
Ano6	A	T	15: 95,894,524	T76S	probably benign	Het
Carmil1	G	T	13: 24,092,550	N204K	probably damaging	Het
Cep126	T	G	9: 8,103,439	N190T	possibly damaging	Het
Clasrp	A	T	7: 19,591,109	D198E	probably damaging	Het
Cma1	T	C	14: 55,944,520	T18A	probably benign	Het
Ece1	A	G	4: 137,956,533	I565M	probably damaging	Het
Etl4	T	A	2: 20,806,512	F1135L	probably damaging	Het
Fbxw20	T	C	9: 109,223,290	N325S	probably damaging	Het
Fbxw20	A	T	9: 109,233,600	C53S	possibly damaging	Het
Gnb2	T	C	5: 137,528,699	D203G	probably benign	Het
Hoxd9	T	A	2: 74,699,273	F291Y	probably damaging	Het
Igf2r	T	C	17: 12,709,445	S1004G	probably benign	Het
Irgm1	T	C	11: 48,866,237	Y249C	probably damaging	Het
Kcnh3	A	C	15: 99,232,974	I491L	probably benign	Het
Kctd10	G	A	5: 114,367,337	R199W	probably damaging	Het
Klk1b4	A	T	7: 44,209,645	N29I	probably damaging	Het
Klrc1	C	T	6: 129,675,354	R188Q	probably damaging	Het
Krt32	C	A	11: 100,084,986	C275F	probably damaging	Het
Krt73	T	A	15: 101,794,829	T449S	probably benign	Het
Napepld	T	A	5: 21,683,431	S7C	possibly damaging	Het
Nfia	G	T	4: 97,783,601	V183L	possibly damaging	Het
Olfr788	A	C	10: 129,473,426	I245L	possibly damaging	Het
Olfr996	T	C	2: 85,579,341	V34A	probably benign	Het
Psma3	A	G	12: 70,990,497	T111A	probably benign	Het
Psmd11	T	A	11: 80,471,492	D125E	probably benign	Het
Rabgap1	T	A	2: 37,502,902	D523E	probably benign	Het
Rttn	G	T	18: 88,995,569	R454L	probably benign	Het
Serpine2	T	C	1: 79,821,439	N33D	probably benign	Het
Six4	A	T	12: 73,112,350	S271T	possibly damaging	Het
Smoc2	T	A	17: 14,369,048	C260S	possibly damaging	Het
Snai2	A	T	16: 14,706,726	Y32F	probably benign	Het
Tapt1	C	T	5: 44,177,134	G505D	probably benign	Het
Thap12	T	A	7: 98,716,393	D589E	probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r116	T	C	17: 23,385,968	I85T	probably damaging	Het
Zfp592	G	T	7: 81,025,033	V582L	probably benign	Het
Zfp827	T	C	8: 79,070,442	W386R	probably damaging	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- AGGATGGTCTCATAGCCCAC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- GGGTACATGTCCCCCTGGTAG -3'

Posted On

2016-12-15