Incidental Mutation 'R5794:Psma3'
ID447133
Institutional Source Beutler Lab
Gene Symbol Psma3
Ensembl Gene ENSMUSG00000060073
Gene Nameproteasome (prosome, macropain) subunit, alpha type 3
SynonymsLmpc8
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70974621-70996347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70990497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000124894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071704] [ENSMUST00000160027] [ENSMUST00000160864] [ENSMUST00000162626] [ENSMUST00000162851]
Predicted Effect probably benign
Transcript: ENSMUST00000071704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127129
Predicted Effect probably benign
Transcript: ENSMUST00000160027
AA Change: T186A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125548
Gene: ENSMUSG00000060073
AA Change: T186A

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Pfam:Proteasome 31 217 6.2e-53 PFAM
low complexity region 241 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160683
Predicted Effect probably benign
Transcript: ENSMUST00000160864
AA Change: T111A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124894
Gene: ENSMUSG00000060073
AA Change: T111A

DomainStartEndE-ValueType
Pfam:Proteasome 1 142 1.7e-38 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162626
Predicted Effect probably benign
Transcript: ENSMUST00000162851
SMART Domains Protein: ENSMUSP00000124082
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162898
AA Change: T41A
SMART Domains Protein: ENSMUSP00000125490
Gene: ENSMUSG00000060073
AA Change: T41A

DomainStartEndE-ValueType
Pfam:Proteasome 1 53 3.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Psma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Psma3 APN 12 70984674 missense probably benign 0.17
R0316:Psma3 UTSW 12 70983389 missense probably benign 0.01
R0669:Psma3 UTSW 12 70988495 splice site probably benign
R1933:Psma3 UTSW 12 70984694 missense probably benign 0.22
R2288:Psma3 UTSW 12 70994371 missense possibly damaging 0.70
R3745:Psma3 UTSW 12 70978748 missense possibly damaging 0.86
R4479:Psma3 UTSW 12 70984781 unclassified probably benign
R5260:Psma3 UTSW 12 70984642 unclassified probably benign
R5384:Psma3 UTSW 12 70974765 missense probably damaging 1.00
R5457:Psma3 UTSW 12 70984565 missense probably benign
R8348:Psma3 UTSW 12 70988476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAATAGGGACTGAACACATTTC -3'
(R):5'- TGCTGACATTTTCAAAGCCCTG -3'

Sequencing Primer
(F):5'- TGAGACAGTGTCTATATGCACC -3'
(R):5'- GACATTTTCAAAGCCCTGAGTTC -3'
Posted On2016-12-15