Incidental Mutation 'R5794:Six4'
ID447134
Institutional Source Beutler Lab
Gene Symbol Six4
Ensembl Gene ENSMUSG00000034460
Gene Namesine oculis-related homeobox 4
SynonymsTrexBF, AREC3
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73099609-73113456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73112350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 271 (S271T)
Ref Sequence ENSEMBL: ENSMUSP00000135699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043208] [ENSMUST00000175693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043208
AA Change: S279T

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036150
Gene: ENSMUSG00000034460
AA Change: S279T

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:SIX1_SD 101 211 1.6e-47 PFAM
HOX 216 278 7.48e-17 SMART
low complexity region 335 348 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 424 437 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175693
AA Change: S271T

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135699
Gene: ENSMUSG00000034460
AA Change: S271T

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 49 72 N/A INTRINSIC
low complexity region 81 90 N/A INTRINSIC
HOX 208 270 7.48e-17 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox family, subfamily SIX. The drosophila homolog is a nuclear homeoprotein required for eye development. Studies in mouse show that this gene product functions as a transcription factor, and may have a role in the differentiation or maturation of neuronal cells. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and exhibit no apparent abnormalities suggesting compensation by other Six family members. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Six4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Six4 APN 12 73109197 missense probably benign 0.32
IGL02045:Six4 APN 12 73108655 missense probably benign 0.04
IGL02678:Six4 APN 12 73112634 missense probably damaging 1.00
R2473:Six4 UTSW 12 73104175 missense probably benign 0.00
R3409:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3410:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3411:Six4 UTSW 12 73112883 missense probably damaging 0.98
R4175:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4176:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4296:Six4 UTSW 12 73104125 missense probably damaging 1.00
R4303:Six4 UTSW 12 73112540 missense possibly damaging 0.91
R5013:Six4 UTSW 12 73103626 missense probably benign 0.37
R5782:Six4 UTSW 12 73104058 missense probably benign 0.02
R6429:Six4 UTSW 12 73103473 missense probably damaging 1.00
R6650:Six4 UTSW 12 73103525 missense probably benign 0.04
R7018:Six4 UTSW 12 73108953 missense probably benign 0.01
R7464:Six4 UTSW 12 73112530 missense possibly damaging 0.89
R7832:Six4 UTSW 12 73112634 missense probably damaging 1.00
R7871:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7872:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7873:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7956:Six4 UTSW 12 73103761 missense possibly damaging 0.83
R8266:Six4 UTSW 12 73108649 missense possibly damaging 0.53
RF012:Six4 UTSW 12 73103582 frame shift probably null
RF013:Six4 UTSW 12 73103582 frame shift probably null
RF014:Six4 UTSW 12 73103582 frame shift probably null
RF015:Six4 UTSW 12 73103582 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAACTTCAAAGGCAGCAGG -3'
(R):5'- TCAAGGAGAAGTCGCGCAAC -3'

Sequencing Primer
(F):5'- AGTGACCAGCCGAGGTG -3'
(R):5'- GCAACGCGCTCAAGGAG -3'
Posted On2016-12-15