Incidental Mutation 'R5794:Carmil1'
ID447135
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24092550 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 204 (N204K)
Ref Sequence ENSEMBL: ENSMUSP00000126522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]
Predicted Effect probably damaging
Transcript: ENSMUST00000072889
AA Change: N614K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: N614K

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110398
AA Change: N610K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: N610K

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125901
AA Change: N204K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338
AA Change: N204K

DomainStartEndE-ValueType
Blast:LRR 13 40 5e-8 BLAST
Blast:LRR 41 74 4e-9 BLAST
Pfam:LRR_6 75 101 4.4e-2 PFAM
Pfam:LRR_6 164 187 1.6e-3 PFAM
Blast:LRR 192 219 7e-10 BLAST
low complexity region 335 348 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
PDB:3LK3|T 564 676 4e-57 PDB
low complexity region 727 743 N/A INTRINSIC
low complexity region 841 847 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
low complexity region 883 892 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142171
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
R7890:Carmil1 UTSW 13 24013232 missense
R8014:Carmil1 UTSW 13 24036321 missense possibly damaging 0.71
R8068:Carmil1 UTSW 13 24075728 missense probably benign 0.00
R8361:Carmil1 UTSW 13 24067130 critical splice donor site probably null
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTTCGGCGCTTATTCTG -3'
(R):5'- ACTATGTTGCTTGGCATCAGTG -3'

Sequencing Primer
(F):5'- CTGTGCATTAGAAAACTCACATCGGG -3'
(R):5'- ATCAGTGTTGTGTCAGGATGTCAAAG -3'
Posted On2016-12-15