Incidental Mutation 'R5794:Ttc23l'
ID447137
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10551550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 30 (T30K)
Ref Sequence ENSEMBL: ENSMUSP00000022857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1531 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R6976:Ttc23l UTSW 15 10537580 nonsense probably null
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
R7342:Ttc23l UTSW 15 10551497 missense probably benign 0.01
R7404:Ttc23l UTSW 15 10551577 missense probably damaging 0.98
R7453:Ttc23l UTSW 15 10533767 missense probably damaging 1.00
R7584:Ttc23l UTSW 15 10533708 missense probably damaging 1.00
R7599:Ttc23l UTSW 15 10533680 missense possibly damaging 0.89
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Z1177:Ttc23l UTSW 15 10533633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGCTTTCAAATGACAACC -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAAC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'
Posted On2016-12-15