Incidental Mutation 'R5794:Krt73'
ID447141
Institutional Source Beutler Lab
Gene Symbol Krt73
Ensembl Gene ENSMUSG00000063661
Gene Namekeratin 73
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101793308-101802346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101794829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 449 (T449S)
Ref Sequence ENSEMBL: ENSMUSP00000065349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063292]
Predicted Effect probably benign
Transcript: ENSMUST00000063292
AA Change: T449S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: T449S

DomainStartEndE-ValueType
low complexity region 17 57 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.4e-19 PFAM
Filament 130 443 5.39e-159 SMART
low complexity region 450 461 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Krt73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Krt73 APN 15 101798937 critical splice acceptor site probably null
IGL01768:Krt73 APN 15 101798856 missense probably benign 0.01
IGL01836:Krt73 APN 15 101795896 missense probably benign 0.38
IGL02058:Krt73 APN 15 101802021 missense probably benign
IGL02063:Krt73 APN 15 101795769 splice site probably benign
IGL02076:Krt73 APN 15 101799935 missense probably damaging 1.00
IGL02878:Krt73 APN 15 101798826 missense probably damaging 1.00
IGL03127:Krt73 APN 15 101795840 missense probably benign
R0032:Krt73 UTSW 15 101794052 missense probably benign 0.30
R0109:Krt73 UTSW 15 101796395 nonsense probably null
R0143:Krt73 UTSW 15 101800773 missense probably damaging 1.00
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0254:Krt73 UTSW 15 101799889 splice site probably benign
R0256:Krt73 UTSW 15 101801936 missense probably damaging 1.00
R0497:Krt73 UTSW 15 101802230 missense probably damaging 0.99
R1592:Krt73 UTSW 15 101802239 nonsense probably null
R1681:Krt73 UTSW 15 101802047 missense possibly damaging 0.70
R1696:Krt73 UTSW 15 101799909 missense probably damaging 1.00
R1766:Krt73 UTSW 15 101793928 missense probably damaging 1.00
R2031:Krt73 UTSW 15 101798764 splice site probably benign
R2171:Krt73 UTSW 15 101800910 missense possibly damaging 0.88
R4674:Krt73 UTSW 15 101802075 missense probably benign 0.22
R4777:Krt73 UTSW 15 101794001 missense probably benign
R4869:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R4892:Krt73 UTSW 15 101795809 missense probably damaging 0.99
R6807:Krt73 UTSW 15 101796407 missense probably damaging 1.00
R6885:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R7489:Krt73 UTSW 15 101793859 missense probably benign 0.00
R7682:Krt73 UTSW 15 101802045 missense probably benign 0.08
Z1177:Krt73 UTSW 15 101793811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTGGTGAAGAAGTAGCTG -3'
(R):5'- TCATCTTTCTGTGGCAGGGAAG -3'

Sequencing Primer
(F):5'- CCACTGGTGAAGAAGTAGCTGAATAG -3'
(R):5'- AGCCATGAGACAGAGGTTGTTAACTC -3'
Posted On2016-12-15