Incidental Mutation 'R5794:Snai2'
ID447142
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Namesnail family zinc finger 2
SynonymsSnail2, Slug, Slugh
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14705852-14709385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14706726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 32 (Y32F)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
Predicted Effect probably benign
Transcript: ENSMUST00000023356
AA Change: Y32F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: Y32F

DomainStartEndE-ValueType
PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0765:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R0766:Snai2 UTSW 16 14708247 missense possibly damaging 0.71
R1419:Snai2 UTSW 16 14708180 missense possibly damaging 0.85
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4682:Snai2 UTSW 16 14708286 missense probably benign
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
R8160:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAAGGGAAGACTTTATGTGTGTCC -3'
(R):5'- GGGACTTTCTGAACCACTGTG -3'

Sequencing Primer
(F):5'- CCTGTGAGTAAGGCTGTCTTCAC -3'
(R):5'- ACCACTGTGATCCTTGGATGAAG -3'
Posted On2016-12-15