Incidental Mutation 'R5794:Smoc2'
ID447146
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene NameSPARC related modular calcium binding 2
SynonymsSmoc2l, 5430426J21Rik, 1700056C05Rik
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14279506-14404790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14369048 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 260 (C260S)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024660
AA Change: C260S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: C260S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14325614 missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14347233 missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14375527 splice site probably benign
IGL02975:Smoc2 APN 17 14336610 missense probably damaging 0.98
FR4976:Smoc2 UTSW 17 14401562 small deletion probably benign
R2291:Smoc2 UTSW 17 14368971 missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14344342 missense probably benign 0.22
R2888:Smoc2 UTSW 17 14397625 critical splice donor site probably null
R3878:Smoc2 UTSW 17 14325617 missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14369033 missense probably benign 0.12
R5153:Smoc2 UTSW 17 14336579 missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14375457 missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14368965 missense probably benign 0.19
R5292:Smoc2 UTSW 17 14336573 missense probably damaging 0.98
R7810:Smoc2 UTSW 17 14325622 missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14375468 nonsense probably null
X0026:Smoc2 UTSW 17 14336633 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGTCACTGGACTCCAATGC -3'
(R):5'- CTTAAGCAGCAGGAGCACAG -3'

Sequencing Primer
(F):5'- ACTGGACTCCAATGCTGGCTC -3'
(R):5'- CAGAATTCCTGTGTGACAGTCAC -3'
Posted On2016-12-15