Incidental Mutation 'R5794:Smoc2'
ID 447146
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene Name SPARC related modular calcium binding 2
Synonyms 5430426J21Rik, 1700056C05Rik, Smoc2l
MMRRC Submission 043385-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5794 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 14499768-14625052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14589310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 260 (C260S)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
AlphaFold Q8CD91
Predicted Effect possibly damaging
Transcript: ENSMUST00000024660
AA Change: C260S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: C260S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,676,955 (GRCm39) probably null Het
Ank2 T C 3: 126,723,669 (GRCm39) N923S probably benign Het
Ano6 A T 15: 95,792,405 (GRCm39) T76S probably benign Het
Carmil1 G T 13: 24,276,533 (GRCm39) N204K probably damaging Het
Cep126 T G 9: 8,103,440 (GRCm39) N190T possibly damaging Het
Clasrp A T 7: 19,325,034 (GRCm39) D198E probably damaging Het
Cma1 T C 14: 56,181,977 (GRCm39) T18A probably benign Het
Ece1 A G 4: 137,683,844 (GRCm39) I565M probably damaging Het
Etl4 T A 2: 20,811,323 (GRCm39) F1135L probably damaging Het
Fbxw20 T C 9: 109,052,358 (GRCm39) N325S probably damaging Het
Fbxw20 A T 9: 109,062,668 (GRCm39) C53S possibly damaging Het
Gnb2 T C 5: 137,526,961 (GRCm39) D203G probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hoxd9 T A 2: 74,529,617 (GRCm39) F291Y probably damaging Het
Igf2r T C 17: 12,928,332 (GRCm39) S1004G probably benign Het
Irgm1 T C 11: 48,757,064 (GRCm39) Y249C probably damaging Het
Kcnh3 A C 15: 99,130,855 (GRCm39) I491L probably benign Het
Kctd10 G A 5: 114,505,398 (GRCm39) R199W probably damaging Het
Klk1b4 A T 7: 43,859,069 (GRCm39) N29I probably damaging Het
Klrc1 C T 6: 129,652,317 (GRCm39) R188Q probably damaging Het
Krt32 C A 11: 99,975,812 (GRCm39) C275F probably damaging Het
Krt73 T A 15: 101,703,264 (GRCm39) T449S probably benign Het
Napepld T A 5: 21,888,429 (GRCm39) S7C possibly damaging Het
Nfia G T 4: 97,671,838 (GRCm39) V183L possibly damaging Het
Or5g27 T C 2: 85,409,685 (GRCm39) V34A probably benign Het
Or6c3 A C 10: 129,309,295 (GRCm39) I245L possibly damaging Het
Psma3 A G 12: 71,037,271 (GRCm39) T111A probably benign Het
Psmd11 T A 11: 80,362,318 (GRCm39) D125E probably benign Het
Rabgap1 T A 2: 37,392,914 (GRCm39) D523E probably benign Het
Rttn G T 18: 89,013,693 (GRCm39) R454L probably benign Het
Serpine2 T C 1: 79,799,156 (GRCm39) N33D probably benign Het
Six4 A T 12: 73,159,124 (GRCm39) S271T possibly damaging Het
Snai2 A T 16: 14,524,590 (GRCm39) Y32F probably benign Het
Tapt1 C T 5: 44,334,476 (GRCm39) G505D probably benign Het
Thap12 T A 7: 98,365,600 (GRCm39) D589E probably benign Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Vmn2r116 T C 17: 23,604,942 (GRCm39) I85T probably damaging Het
Zfp592 G T 7: 80,674,781 (GRCm39) V582L probably benign Het
Zfp827 T C 8: 79,797,071 (GRCm39) W386R probably damaging Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14,545,876 (GRCm39) missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14,567,495 (GRCm39) missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14,595,789 (GRCm39) splice site probably benign
IGL02975:Smoc2 APN 17 14,556,872 (GRCm39) missense probably damaging 0.98
enamel UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
FR4976:Smoc2 UTSW 17 14,621,824 (GRCm39) small deletion probably benign
R2291:Smoc2 UTSW 17 14,589,233 (GRCm39) missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14,564,604 (GRCm39) missense probably benign 0.22
R2888:Smoc2 UTSW 17 14,617,887 (GRCm39) critical splice donor site probably null
R3878:Smoc2 UTSW 17 14,545,879 (GRCm39) missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14,589,295 (GRCm39) missense probably benign 0.12
R5153:Smoc2 UTSW 17 14,556,841 (GRCm39) missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14,595,719 (GRCm39) missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14,589,227 (GRCm39) missense probably benign 0.19
R5292:Smoc2 UTSW 17 14,556,835 (GRCm39) missense probably damaging 0.98
R7810:Smoc2 UTSW 17 14,545,884 (GRCm39) missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14,595,730 (GRCm39) nonsense probably null
R8811:Smoc2 UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
R9214:Smoc2 UTSW 17 14,556,839 (GRCm39) missense probably damaging 1.00
R9287:Smoc2 UTSW 17 14,619,686 (GRCm39) missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14,556,895 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGTCACTGGACTCCAATGC -3'
(R):5'- CTTAAGCAGCAGGAGCACAG -3'

Sequencing Primer
(F):5'- ACTGGACTCCAATGCTGGCTC -3'
(R):5'- CAGAATTCCTGTGTGACAGTCAC -3'
Posted On 2016-12-15