Incidental Mutation 'R5795:Adipor1'
ID 447151
Institutional Source Beutler Lab
Gene Symbol Adipor1
Ensembl Gene ENSMUSG00000026457
Gene Name adiponectin receptor 1
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 134415378-134433351 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 134424903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 137 (N137K)
Ref Sequence ENSEMBL: ENSMUSP00000107856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027727] [ENSMUST00000112237]
AlphaFold Q91VH1
Predicted Effect probably damaging
Transcript: ENSMUST00000027727
AA Change: N137K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027727
Gene: ENSMUSG00000026457
AA Change: N137K

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 2.2e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112237
AA Change: N137K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107856
Gene: ENSMUSG00000026457
AA Change: N137K

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 7.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148822
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor for the fat-derived hormone adiponectin. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. Homozygous knockout mice for this gene exhibit elevated plasma glucose and insulin levels as well as impaired glucose tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal homeostasis, adipose tissue morphology and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Adipor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Adipor1 APN 1 134431185 missense probably benign 0.07
IGL02186:Adipor1 APN 1 134425960 missense probably benign 0.02
IGL03365:Adipor1 APN 1 134431642 missense possibly damaging 0.67
BB001:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
BB011:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
R0898:Adipor1 UTSW 1 134424076 critical splice donor site probably null
R1625:Adipor1 UTSW 1 134424064 missense possibly damaging 0.88
R1938:Adipor1 UTSW 1 134423103 missense probably benign 0.03
R1956:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1957:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1958:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R2921:Adipor1 UTSW 1 134425993 missense possibly damaging 0.90
R4666:Adipor1 UTSW 1 134424905 missense probably damaging 1.00
R5560:Adipor1 UTSW 1 134426040 missense possibly damaging 0.69
R7924:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
R8317:Adipor1 UTSW 1 134428167 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCTAAAGGCGTCGTGTGTG -3'
(R):5'- CCTTGGCAAGTAAGATTGGAATTC -3'

Sequencing Primer
(F):5'- CTAAAGGCGTCGTGTGTGTTGTAG -3'
(R):5'- ATGACTAGAATGGTGCCC -3'
Posted On 2016-12-15