Incidental Mutation 'R5795:Traf5'
ID 447154
Institutional Source Beutler Lab
Gene Symbol Traf5
Ensembl Gene ENSMUSG00000026637
Gene Name TNF receptor-associated factor 5
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 191997205-192092559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 191999846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 345 (S345G)
Ref Sequence ENSEMBL: ENSMUSP00000082710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085573]
AlphaFold P70191
Predicted Effect probably benign
Transcript: ENSMUST00000085573
AA Change: S345G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: S345G

DomainStartEndE-ValueType
RING 45 84 1.74e-4 SMART
Pfam:zf-TRAF 128 183 4.8e-21 PFAM
Pfam:zf-TRAF 183 241 4.2e-19 PFAM
MATH 402 525 2.42e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175262
Predicted Effect unknown
Transcript: ENSMUST00000192628
AA Change: S42G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194408
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Traf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Traf5 APN 1 192057174 missense possibly damaging 0.95
IGL01462:Traf5 APN 1 191999867 missense probably benign
IGL02262:Traf5 APN 1 191997675 missense probably damaging 1.00
IGL02579:Traf5 APN 1 191999887 missense probably damaging 0.99
IGL03308:Traf5 APN 1 191997500 missense probably damaging 0.99
PIT4445001:Traf5 UTSW 1 191997807 missense
R0028:Traf5 UTSW 1 192074121 intron probably benign
R0689:Traf5 UTSW 1 191997876 missense probably benign 0.16
R1511:Traf5 UTSW 1 191999951 missense probably benign 0.01
R1641:Traf5 UTSW 1 191997509 missense probably benign 0.20
R2235:Traf5 UTSW 1 192054391 missense probably damaging 1.00
R2246:Traf5 UTSW 1 192066890 splice site probably null
R2301:Traf5 UTSW 1 191997965 missense probably benign 0.01
R3973:Traf5 UTSW 1 191997876 missense probably benign 0.16
R4396:Traf5 UTSW 1 191997845 missense probably benign 0.22
R4793:Traf5 UTSW 1 191997804 missense probably benign 0.38
R4834:Traf5 UTSW 1 192066898 missense probably benign 0.10
R5779:Traf5 UTSW 1 191997672 missense probably damaging 1.00
R5843:Traf5 UTSW 1 191997485 missense possibly damaging 0.55
R5912:Traf5 UTSW 1 191998069 intron probably benign
R5963:Traf5 UTSW 1 192000016 missense probably benign 0.06
R6246:Traf5 UTSW 1 192070553 missense probably damaging 0.99
R6287:Traf5 UTSW 1 191999872 missense probably damaging 1.00
R6455:Traf5 UTSW 1 191999926 missense probably benign 0.00
R7248:Traf5 UTSW 1 192059017 missense probably benign 0.20
R7452:Traf5 UTSW 1 191999831 missense
R8147:Traf5 UTSW 1 192062684 missense probably damaging 1.00
R9301:Traf5 UTSW 1 191997528 missense
R9307:Traf5 UTSW 1 192062733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGCTAGAATCTCATGCTG -3'
(R):5'- CAAATCCGATGTCTCGTTTCCAAG -3'

Sequencing Primer
(F):5'- TGCTGCTTCACAAACAGGATTCAG -3'
(R):5'- GATGTCTCGTTTCCAAGACATATTC -3'
Posted On 2016-12-15