Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Tanc1'

447157

Institutional Source

Beutler Lab

Gene Symbol

Tanc1

Ensembl Gene

ENSMUSG00000035168

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

Synonyms

1200003E16Rik

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5795 (G1)

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

59612042-59846149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59807582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 876 (T876A)

Ref Sequence

ENSEMBL: ENSMUSP00000123345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]

AlphaFold

Q0VGY8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037526
AA Change: T876A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: T876A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000056900

Predicted Effect

probably benign
Transcript: ENSMUST00000112568
AA Change: T869A

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: T869A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	432	444	N/A	INTRINSIC
low complexity region	448	468	N/A	INTRINSIC
ANK	886	918	1.06e3	SMART
ANK	922	953	2.43e3	SMART
ANK	957	986	1.12e-3	SMART
Blast:ANK	990	1021	7e-12	BLAST
ANK	1030	1059	1.78e3	SMART
ANK	1068	1097	2.34e-1	SMART
ANK	1101	1130	3.71e-4	SMART
ANK	1134	1163	1.51e-4	SMART
ANK	1167	1196	4.89e-4	SMART
ANK	1200	1229	3.01e-4	SMART
ANK	1233	1262	1.99e2	SMART
TPR	1279	1312	7.49e1	SMART
TPR	1326	1359	2.35e-1	SMART
TPR	1360	1393	6.29e-2	SMART
low complexity region	1409	1425	N/A	INTRINSIC
low complexity region	1447	1476	N/A	INTRINSIC
low complexity region	1649	1679	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139863
AA Change: T876A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: T876A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162857

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hephl1	C	T	9: 15,069,760	G792E	probably damaging	Het
Hmmr	T	A	11: 40,721,906	D158V	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Lrp4	A	G	2: 91,474,471	D224G	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r104	G	T	17: 20,030,110	T633N	probably benign	Het
Vmn2r104	A	G	17: 20,030,282	S576P	possibly damaging	Het
Vmn2r105	A	T	17: 20,228,736	C60S	probably benign	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Tanc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tanc1	APN	2	59790841	missense	possibly damaging	0.84
IGL00484:Tanc1	APN	2	59793176	missense	probably benign	0.00
IGL00688:Tanc1	APN	2	59815391	missense	probably damaging	1.00
IGL00765:Tanc1	APN	2	59806301	missense	probably benign	0.15
IGL01576:Tanc1	APN	2	59797735	missense	probably damaging	1.00
IGL01590:Tanc1	APN	2	59785473	missense	probably benign
IGL02016:Tanc1	APN	2	59843590	missense	probably benign	0.00
IGL02373:Tanc1	APN	2	59796028	critical splice donor site	probably null
IGL02539:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02540:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02541:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02543:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02559:Tanc1	APN	2	59724654	splice site	probably benign
IGL02626:Tanc1	APN	2	59799872	missense	probably damaging	1.00
IGL02669:Tanc1	APN	2	59799986	missense	probably damaging	1.00
IGL02902:Tanc1	APN	2	59793087	splice site	probably benign
Oreja	UTSW	2	59791804	synonymous	silent
R0178:Tanc1	UTSW	2	59835447	nonsense	probably null
R0347:Tanc1	UTSW	2	59842991	missense	probably benign
R0570:Tanc1	UTSW	2	59796038	splice site	probably benign
R0660:Tanc1	UTSW	2	59843884	nonsense	probably null
R0664:Tanc1	UTSW	2	59843884	nonsense	probably null
R0898:Tanc1	UTSW	2	59790788	missense	probably damaging	1.00
R1333:Tanc1	UTSW	2	59843491	missense	probably benign
R1575:Tanc1	UTSW	2	59791651	missense	probably damaging	1.00
R1608:Tanc1	UTSW	2	59797694	missense	possibly damaging	0.80
R1616:Tanc1	UTSW	2	59785387	missense	probably damaging	1.00
R1703:Tanc1	UTSW	2	59843021	missense	probably benign	0.02
R1727:Tanc1	UTSW	2	59790809	missense	probably damaging	1.00
R1809:Tanc1	UTSW	2	59800097	missense	probably damaging	1.00
R1812:Tanc1	UTSW	2	59791679	missense	probably damaging	1.00
R1925:Tanc1	UTSW	2	59724751	missense	possibly damaging	0.48
R1951:Tanc1	UTSW	2	59791812	missense	possibly damaging	0.92
R2174:Tanc1	UTSW	2	59843833	missense	possibly damaging	0.72
R2228:Tanc1	UTSW	2	59724724	missense	probably benign	0.04
R2267:Tanc1	UTSW	2	59837219	critical splice donor site	probably null
R4191:Tanc1	UTSW	2	59839013	missense	probably damaging	1.00
R4476:Tanc1	UTSW	2	59841996	splice site	probably null
R4632:Tanc1	UTSW	2	59795835	missense	probably damaging	1.00
R4825:Tanc1	UTSW	2	59699422	missense	probably damaging	1.00
R4982:Tanc1	UTSW	2	59799943	missense	probably damaging	1.00
R5338:Tanc1	UTSW	2	59795834	missense	probably damaging	1.00
R5657:Tanc1	UTSW	2	59834707	splice site	probably null
R5672:Tanc1	UTSW	2	59772353	missense	possibly damaging	0.81
R5703:Tanc1	UTSW	2	59795997	missense	probably damaging	0.98
R5707:Tanc1	UTSW	2	59758530	missense	probably benign
R5778:Tanc1	UTSW	2	59699347	critical splice acceptor site	probably null
R5831:Tanc1	UTSW	2	59785341	missense	possibly damaging	0.89
R5849:Tanc1	UTSW	2	59799904	missense	probably benign	0.00
R5912:Tanc1	UTSW	2	59791686	missense	possibly damaging	0.92
R5944:Tanc1	UTSW	2	59837220	critical splice donor site	probably null
R6057:Tanc1	UTSW	2	59817493	missense	possibly damaging	0.46
R6142:Tanc1	UTSW	2	59833222	nonsense	probably null
R6179:Tanc1	UTSW	2	59842976	missense	probably benign	0.42
R6185:Tanc1	UTSW	2	59791585	splice site	probably null
R6192:Tanc1	UTSW	2	59838961	splice site	probably null
R6196:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6197:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6230:Tanc1	UTSW	2	59842031	missense	probably damaging	1.00
R6275:Tanc1	UTSW	2	59843510	missense	probably benign	0.22
R6415:Tanc1	UTSW	2	59837114	missense	probably benign	0.02
R6480:Tanc1	UTSW	2	59807642	missense	probably damaging	1.00
R6578:Tanc1	UTSW	2	59795954	missense	probably damaging	1.00
R6786:Tanc1	UTSW	2	59791806	missense	probably benign	0.00
R7006:Tanc1	UTSW	2	59795844	missense	probably damaging	1.00
R7133:Tanc1	UTSW	2	59797609	missense	probably benign	0.16
R7381:Tanc1	UTSW	2	59785326	missense	probably damaging	1.00
R7422:Tanc1	UTSW	2	59806344	missense	probably benign	0.02
R8392:Tanc1	UTSW	2	59806307	missense	probably damaging	0.99
R8692:Tanc1	UTSW	2	59843645	missense	probably benign	0.01
R8730:Tanc1	UTSW	2	59771246	missense	probably benign	0.00
R8731:Tanc1	UTSW	2	59843252	missense	probably benign	0.01
R8813:Tanc1	UTSW	2	59799921	missense	probably damaging	1.00
R8815:Tanc1	UTSW	2	59790841	missense	possibly damaging	0.84
R8933:Tanc1	UTSW	2	59785456	missense	possibly damaging	0.92
R9015:Tanc1	UTSW	2	59791880	missense	probably benign
R9042:Tanc1	UTSW	2	59843422	missense	probably benign	0.00
R9154:Tanc1	UTSW	2	59799788	missense	probably damaging	1.00
R9269:Tanc1	UTSW	2	59800088	missense	probably damaging	1.00
R9283:Tanc1	UTSW	2	59799830	missense	probably damaging	0.99
R9380:Tanc1	UTSW	2	59835452	missense	probably damaging	1.00
R9422:Tanc1	UTSW	2	59807589	missense	probably benign	0.08
R9428:Tanc1	UTSW	2	59771204	missense	probably damaging	1.00
RF028:Tanc1	UTSW	2	59843269	small deletion	probably benign
RF049:Tanc1	UTSW	2	59843269	small deletion	probably benign
X0063:Tanc1	UTSW	2	59843980	nonsense	probably null
X0064:Tanc1	UTSW	2	59844112	missense	probably damaging	1.00
Z1176:Tanc1	UTSW	2	59772529	missense	possibly damaging	0.93
Z1177:Tanc1	UTSW	2	59790887	missense	probably benign
Z1177:Tanc1	UTSW	2	59791830	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATATAGTTGACAGGGCCTG -3'
(R):5'- CATCACCAGGAGAACCTCTG -3'

Sequencing Primer
(F):5'- CATATAGTTGACAGGGCCTGTGGTC -3'
(R):5'- AGGAGAACCTCTGCCCTCTCAG -3'

Posted On

2016-12-15