Incidental Mutation 'R5795:Gm14085'
ID 447159
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Name predicted gene 14085
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 122484941-122528040 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122517994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 274 (M274T)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000110521
AA Change: M274T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: M274T

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122517046 missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122524796 critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122517983 missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122525091 missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122514514 splice site probably benign
Wilted UTSW 2 122523482 missense probably damaging 1.00
K2124:Gm14085 UTSW 2 122525153 missense probably benign 0.00
R0084:Gm14085 UTSW 2 122522833 missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122517597 splice site probably benign
R0127:Gm14085 UTSW 2 122517069 critical splice donor site probably null
R0200:Gm14085 UTSW 2 122527447 makesense probably null
R0276:Gm14085 UTSW 2 122521928 missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122517553 missense probably benign 0.04
R0403:Gm14085 UTSW 2 122521854 missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122514398 missense probably damaging 0.97
R0612:Gm14085 UTSW 2 122521698 missense probably damaging 1.00
R1676:Gm14085 UTSW 2 122521859 missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122521652 missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122527429 missense probably benign 0.00
R2050:Gm14085 UTSW 2 122522868 missense probably benign 0.21
R3078:Gm14085 UTSW 2 122514414 missense possibly damaging 0.63
R4075:Gm14085 UTSW 2 122514411 missense probably benign 0.00
R4096:Gm14085 UTSW 2 122522728 missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122522805 nonsense probably null
R4796:Gm14085 UTSW 2 122514459 missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122522914 critical splice donor site probably null
R5069:Gm14085 UTSW 2 122494373 missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5385:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5386:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5442:Gm14085 UTSW 2 122486869 missense probably benign
R6258:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122524807 missense probably benign 0.00
R7226:Gm14085 UTSW 2 122522532 missense probably benign 0.00
R7574:Gm14085 UTSW 2 122522844 missense not run
R7633:Gm14085 UTSW 2 122486680 missense probably null 0.05
R7705:Gm14085 UTSW 2 122521629 critical splice acceptor site probably null
R7726:Gm14085 UTSW 2 122486733 missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122494358 missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122521688 missense probably damaging 1.00
R8337:Gm14085 UTSW 2 122525136 missense probably benign 0.06
R8546:Gm14085 UTSW 2 122522754 missense probably benign 0.14
R8817:Gm14085 UTSW 2 122518507 missense possibly damaging 0.95
R8931:Gm14085 UTSW 2 122518502 missense
R9070:Gm14085 UTSW 2 122521673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATAGCCTGCAGTGCATTC -3'
(R):5'- TTTGATACCAGGATGCTTCAGAG -3'

Sequencing Primer
(F):5'- GCAGTGCATTCTGAGTTTATTCC -3'
(R):5'- TACCAGGATGCTTCAGAGAGATTGC -3'
Posted On 2016-12-15