Incidental Mutation 'R5795:Chmp5'
ID 447162
Institutional Source Beutler Lab
Gene Symbol Chmp5
Ensembl Gene ENSMUSG00000028419
Gene Name charged multivesicular body protein 5
Synonyms 2210412K09Rik, chromatin modifying protein 5
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 40948407-40965303 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 40950562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030125] [ENSMUST00000030128] [ENSMUST00000108089] [ENSMUST00000191273] [ENSMUST00000215842]
AlphaFold Q9D7S9
Predicted Effect probably benign
Transcript: ENSMUST00000030125
SMART Domains Protein: ENSMUSP00000030125
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 69 79 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
UBQ 154 230 9.52e-11 SMART
low complexity region 235 248 N/A INTRINSIC
BAG 256 336 1.92e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030128
SMART Domains Protein: ENSMUSP00000030128
Gene: ENSMUSG00000028419

DomainStartEndE-ValueType
Pfam:Snf7 12 197 5.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108089
SMART Domains Protein: ENSMUSP00000103724
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
UBQ 18 94 9.52e-11 SMART
low complexity region 99 112 N/A INTRINSIC
BAG 120 200 1.92e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191273
SMART Domains Protein: ENSMUSP00000139864
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
UBQ 18 94 9.52e-11 SMART
low complexity region 99 112 N/A INTRINSIC
BAG 120 200 1.92e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215842
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHMP5 belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, cardia bifida, impaired chorioallantoic fusion, abnormal somite and neural plate devlopment, accumulation of multivesicular bodies, and impaired endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Chmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03077:Chmp5 APN 4 40952438 missense probably benign 0.34
R0480:Chmp5 UTSW 4 40948690 unclassified probably benign
R0831:Chmp5 UTSW 4 40949500 missense probably damaging 1.00
R0909:Chmp5 UTSW 4 40960968 missense probably benign 0.00
R5052:Chmp5 UTSW 4 40948608 start codon destroyed probably null 0.54
R7121:Chmp5 UTSW 4 40952217 splice site probably null
R7749:Chmp5 UTSW 4 40949488 missense probably damaging 1.00
R8861:Chmp5 UTSW 4 40964608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCTGGGCATTAGAATTATC -3'
(R):5'- TTGCCAGCCAAAGTGATCCC -3'

Sequencing Primer
(F):5'- ATCTGTGCTCGAAGCTTGAAGAG -3'
(R):5'- ATCCCACGTGGCTGCTGAAG -3'
Posted On 2016-12-15