Incidental Mutation 'R5795:Mycl'
ID 447164
Institutional Source Beutler Lab
Gene Symbol Mycl
Ensembl Gene ENSMUSG00000028654
Gene Name v-myc avian myelocytomatosis viral oncogene lung carcinoma derived
Synonyms Lmyc-1, Lmyc1, bHLHe38, L-myc, Mycl1
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5795 (G1)
Quality Score 199
Status Not validated
Chromosome 4
Chromosomal Location 122995652-123002485 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122996622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 34 (E34K)
Ref Sequence ENSEMBL: ENSMUSP00000117232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030407] [ENSMUST00000106252] [ENSMUST00000144998]
AlphaFold P10166
Predicted Effect probably damaging
Transcript: ENSMUST00000030407
AA Change: E34K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030407
Gene: ENSMUSG00000028654
AA Change: E34K

DomainStartEndE-ValueType
Pfam:Myc_N 1 161 6.7e-29 PFAM
Pfam:Myc_N 137 230 1.1e-11 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106252
AA Change: E34K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101859
Gene: ENSMUSG00000028654
AA Change: E34K

DomainStartEndE-ValueType
Pfam:Myc_N 1 157 3.4e-31 PFAM
Pfam:Myc_N 116 231 1e-9 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135925
Predicted Effect probably damaging
Transcript: ENSMUST00000144998
AA Change: E34K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117232
Gene: ENSMUSG00000028654
AA Change: E34K

DomainStartEndE-ValueType
Pfam:Myc_N 1 58 7.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147259
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix leucine zipper (bHLHZip) protein that heterodimerizes with another bHLHZip protein to drive transcription of targets important for proliferation, apoptosis and differentiation. Mice lacking this gene product show marked decrease in T-cell priming during bacterial and viral infections. In humans, this gene was found to be amplified in small-cell lung cancers. Alternate splicing of this gene results in multiple variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null allele are viable, fertile and apparently healthy with no congenital defects or gross morphological/cellular alterations of the CNS, lung, kidney and GI tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Mycl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Mycl APN 4 122996977 missense probably damaging 1.00
IGL02678:Mycl APN 4 122999983 missense probably damaging 1.00
R1509:Mycl UTSW 4 123000307 missense probably damaging 1.00
R2348:Mycl UTSW 4 122996952 missense probably benign 0.07
R4050:Mycl UTSW 4 122996839 splice site probably null
R4209:Mycl UTSW 4 122999922 missense possibly damaging 0.57
R4798:Mycl UTSW 4 123000256 missense probably damaging 1.00
R5267:Mycl UTSW 4 123000496 missense probably damaging 1.00
R6195:Mycl UTSW 4 122999920 missense probably damaging 1.00
R6233:Mycl UTSW 4 122999920 missense probably damaging 1.00
R6854:Mycl UTSW 4 123000246 missense probably damaging 1.00
R7050:Mycl UTSW 4 122997020 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTTTGCTTTGAACTCGCTCC -3'
(R):5'- ATGCAGTCACGGCGAATGATG -3'

Sequencing Primer
(F):5'- TTGCGAGCTGCCCTGAG -3'
(R):5'- GGAAGCATAATTCCTGCCCCAG -3'
Posted On 2016-12-15