Incidental Mutation 'R5795:Bmp8b'
ID447165
Institutional Source Beutler Lab
Gene Symbol Bmp8b
Ensembl Gene ENSMUSG00000002384
Gene Namebone morphogenetic protein 8b
SynonymsOp3
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5795 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123105165-123132099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123121968 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 249 (F249L)
Ref Sequence ENSEMBL: ENSMUSP00000002457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002457
AA Change: F249L

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384
AA Change: F249L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The encoded protein may play a role in the generation of primordial germ cells, and has been shown to stimulate thermogenesis in brown adipose tissue. Male mice lacking a functional copy of this gene exhibit variable degrees of germ-cell deficiency. Homozygous knockout mice of both sexes exhibit impaired thermogenesis and reduced metabolic rate, resulting in weight gain. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Bmp8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Bmp8b APN 4 123124409 missense probably benign 0.19
R0334:Bmp8b UTSW 4 123114760 splice site probably null
R0441:Bmp8b UTSW 4 123124515 missense probably damaging 1.00
R0472:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0609:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0732:Bmp8b UTSW 4 123105406 missense unknown
R1221:Bmp8b UTSW 4 123114711 missense probably damaging 1.00
R2200:Bmp8b UTSW 4 123123022 missense possibly damaging 0.81
R3847:Bmp8b UTSW 4 123116168 unclassified probably benign
R4003:Bmp8b UTSW 4 123121878 unclassified probably benign
R4777:Bmp8b UTSW 4 123122000 missense possibly damaging 0.61
R4834:Bmp8b UTSW 4 123123050 missense probably damaging 1.00
R4911:Bmp8b UTSW 4 123115237 missense probably damaging 1.00
R5207:Bmp8b UTSW 4 123115921 unclassified probably benign
R5509:Bmp8b UTSW 4 123114576 missense possibly damaging 0.78
R5549:Bmp8b UTSW 4 123124485 missense probably damaging 1.00
R6142:Bmp8b UTSW 4 123115250 missense probably benign
R7549:Bmp8b UTSW 4 123105655 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TACGGAGGTCCCTGTTTCTGTC -3'
(R):5'- TGAGGGACTGGAAGGTACTC -3'

Sequencing Primer
(F):5'- TGTCACCTCAGACCTGCTGG -3'
(R):5'- GACTGGAAGGTACTCCACTCTAAAG -3'
Posted On2016-12-15