Incidental Mutation 'R5795:Crocc'
ID447166
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 043386-MU
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R5795 (G1)
Quality Score217
Status Not validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCTGAGCTGCTGAGCTGC to TCTGAGCTGC at 141041807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000168157]
Predicted Effect probably null
Transcript: ENSMUST00000040222
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097816
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102491
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126863
Predicted Effect probably null
Transcript: ENSMUST00000168157
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1561:Crocc UTSW 4 141030268 missense probably damaging 1.00
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R1935:Crocc UTSW 4 141034058 missense possibly damaging 0.78
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2130:Crocc UTSW 4 141029102 missense probably benign 0.04
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4591:Crocc UTSW 4 141018672 missense probably damaging 1.00
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R4992:Crocc UTSW 4 141046666 missense probably damaging 0.98
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
R7086:Crocc UTSW 4 141047057 missense possibly damaging 0.47
R7282:Crocc UTSW 4 141022341 missense probably damaging 1.00
R7293:Crocc UTSW 4 141043556 missense probably benign 0.17
R7404:Crocc UTSW 4 141026186 missense possibly damaging 0.46
R7571:Crocc UTSW 4 141046049 critical splice acceptor site probably null
R7646:Crocc UTSW 4 141021655 missense probably null 0.94
R7782:Crocc UTSW 4 141025286 missense probably benign 0.05
R8053:Crocc UTSW 4 141042919 critical splice donor site unknown
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TATCAGCAGCTATGGTCCCC -3'
(R):5'- AACCGTGATGGCACTGAAGG -3'

Sequencing Primer
(F):5'- TGACTACCTGAACCTGTAGCTGG -3'
(R):5'- AAGGGCAGTGAGGGTTTTGC -3'
Posted On2016-12-15