Incidental Mutation 'R5795:Ogfod2'
ID 447167
Institutional Source Beutler Lab
Gene Symbol Ogfod2
Ensembl Gene ENSMUSG00000023707
Gene Name 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124112297-124115483 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124114761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 278 (G278D)
Ref Sequence ENSEMBL: ENSMUSP00000024470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024470] [ENSMUST00000031351] [ENSMUST00000086123] [ENSMUST00000119269] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000198505] [ENSMUST00000196627] [ENSMUST00000196401] [ENSMUST00000161938] [ENSMUST00000198770] [ENSMUST00000162812] [ENSMUST00000149835] [ENSMUST00000161273]
AlphaFold Q9CQ04
Predicted Effect probably damaging
Transcript: ENSMUST00000024470
AA Change: G278D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024470
Gene: ENSMUSG00000023707
AA Change: G278D

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 100 2e-6 BLAST
low complexity region 102 112 N/A INTRINSIC
P4Hc 136 307 7.91e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031351
SMART Domains Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 7 227 2.7e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086123
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119269
SMART Domains Protein: ENSMUSP00000112701
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-22 BLAST
Blast:P4Hc 136 175 1e-20 BLAST
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122394
SMART Domains Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 2 199 6.3e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143062
Predicted Effect probably benign
Transcript: ENSMUST00000145667
SMART Domains Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 19 227 3e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148365
Predicted Effect probably benign
Transcript: ENSMUST00000198505
SMART Domains Protein: ENSMUSP00000142965
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196627
SMART Domains Protein: ENSMUSP00000143698
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196401
SMART Domains Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 29 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161938
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199457
Predicted Effect probably benign
Transcript: ENSMUST00000198770
SMART Domains Protein: ENSMUSP00000143318
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
Blast:P4Hc 11 102 7e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162812
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149835
SMART Domains Protein: ENSMUSP00000116269
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 5 32 N/A INTRINSIC
SCOP:d1l9ha_ 58 84 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161273
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Ogfod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ogfod2 APN 5 124112847 critical splice donor site probably null
IGL03304:Ogfod2 APN 5 124112823 missense probably damaging 0.99
R0018:Ogfod2 UTSW 5 124114525 unclassified probably benign
R0681:Ogfod2 UTSW 5 124112844 missense probably null 1.00
R0751:Ogfod2 UTSW 5 124113476 unclassified probably benign
R1744:Ogfod2 UTSW 5 124114156 splice site probably null
R1800:Ogfod2 UTSW 5 124114956 missense probably damaging 1.00
R2211:Ogfod2 UTSW 5 124112780 splice site probably null
R3977:Ogfod2 UTSW 5 124113209 splice site probably null
R4346:Ogfod2 UTSW 5 124113294 missense probably damaging 1.00
R4508:Ogfod2 UTSW 5 124113254 nonsense probably null
R4537:Ogfod2 UTSW 5 124114528 unclassified probably benign
R6647:Ogfod2 UTSW 5 124114803 missense possibly damaging 0.95
R7101:Ogfod2 UTSW 5 124114495 missense unknown
R8001:Ogfod2 UTSW 5 124114883 missense probably damaging 1.00
R8139:Ogfod2 UTSW 5 124113475 missense possibly damaging 0.69
R9080:Ogfod2 UTSW 5 124114944 missense probably damaging 0.99
R9258:Ogfod2 UTSW 5 124112442 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGCAAGGACTTCACAG -3'
(R):5'- TCAGCATCAACACCTCTGG -3'

Sequencing Primer
(F):5'- AGGGGGTGCCCTGTATTTTG -3'
(R):5'- TCAACACCTCTGGGGGAGAAC -3'
Posted On 2016-12-15