Incidental Mutation 'R5795:Brat1'
ID 447168
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene Name BRCA1-associated ATM activator 1
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 140705011-140719379 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140713072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 275 (A275S)
Ref Sequence ENSEMBL: ENSMUSP00000106429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000153440]
AlphaFold Q8C3R1
Predicted Effect probably benign
Transcript: ENSMUST00000041588
AA Change: A275S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148
AA Change: A275S

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100505
AA Change: A320S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148
AA Change: A320S

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110806
AA Change: A275S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148
AA Change: A275S

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect probably benign
Transcript: ENSMUST00000153440
AA Change: A275S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148
AA Change: A275S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140717177 missense probably damaging 1.00
IGL01327:Brat1 APN 5 140718208 nonsense probably null
IGL01897:Brat1 APN 5 140717915 missense probably benign 0.00
IGL01965:Brat1 APN 5 140718056 missense probably benign 0.01
IGL02437:Brat1 APN 5 140712808 missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140705995 missense probably damaging 1.00
R0394:Brat1 UTSW 5 140718386 missense probably damaging 1.00
R1256:Brat1 UTSW 5 140710207 missense possibly damaging 0.87
R1426:Brat1 UTSW 5 140718013 missense probably benign 0.00
R1474:Brat1 UTSW 5 140712627 missense probably benign
R1848:Brat1 UTSW 5 140718509 missense possibly damaging 0.94
R2205:Brat1 UTSW 5 140705133 intron probably benign
R3901:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R3902:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R4467:Brat1 UTSW 5 140705071 utr 5 prime probably benign
R4751:Brat1 UTSW 5 140718296 missense probably damaging 1.00
R6151:Brat1 UTSW 5 140705961 missense probably benign 0.00
R7162:Brat1 UTSW 5 140710249 missense probably benign 0.00
R8247:Brat1 UTSW 5 140713138 missense possibly damaging 0.88
R8901:Brat1 UTSW 5 140712853 missense probably benign 0.17
R8934:Brat1 UTSW 5 140710249 missense probably benign 0.00
X0026:Brat1 UTSW 5 140714938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGACCTTCTTCTTAGTGTGGC -3'
(R):5'- TGGCCCATTCTCACATTTGG -3'

Sequencing Primer
(F):5'- CTTAGTGTGGCCAGGTCAG -3'
(R):5'- TGGCTCCCGGTTTCCAAAG -3'
Posted On 2016-12-15