Incidental Mutation 'R5795:C5ar1'
ID 447171
Institutional Source Beutler Lab
Gene Symbol C5ar1
Ensembl Gene ENSMUSG00000049130
Gene Name complement component 5a receptor 1
Synonyms C5aR, D7Msu1, Cd88, C5r1
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 16246743-16259540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16248394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 234 (K234E)
Ref Sequence ENSEMBL: ENSMUSP00000129972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050770] [ENSMUST00000168818] [ENSMUST00000171425] [ENSMUST00000209442]
AlphaFold P30993
Predicted Effect possibly damaging
Transcript: ENSMUST00000050770
AA Change: K234E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060003
Gene: ENSMUSG00000049130
AA Change: K234E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2.2e-5 PFAM
Pfam:7tm_1 54 301 9.4e-41 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168818
AA Change: K234E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129972
Gene: ENSMUSG00000049130
AA Change: K234E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2e-5 PFAM
Pfam:7tm_1 54 301 9.2e-52 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171425
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209442
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous targeted mutants have impaired C5 responses that can show increased or decreased acute inflammation under different circumstances, and thus affect severity of disease or infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in C5ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:C5ar1 UTSW 7 16248939 missense probably damaging 1.00
R1338:C5ar1 UTSW 7 16248335 missense probably damaging 1.00
R1527:C5ar1 UTSW 7 16248193 missense probably damaging 1.00
R4477:C5ar1 UTSW 7 16248864 missense probably damaging 1.00
R4812:C5ar1 UTSW 7 16248333 splice site probably null
R5963:C5ar1 UTSW 7 16248822 missense possibly damaging 0.60
R6993:C5ar1 UTSW 7 16248912 missense probably damaging 1.00
R7294:C5ar1 UTSW 7 16249025 missense probably benign 0.00
R7464:C5ar1 UTSW 7 16248766 missense probably benign 0.07
R7619:C5ar1 UTSW 7 16248579 missense probably damaging 1.00
R8520:C5ar1 UTSW 7 16248151 missense probably damaging 1.00
R8934:C5ar1 UTSW 7 16248477 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTGATGTAGGCCAGGGAC -3'
(R):5'- CTGGGTCTTAGCATTGCTCC -3'

Sequencing Primer
(F):5'- ACACGCACAGGGAGTTCAGC -3'
(R):5'- ATCCTTCGTGTACCGGGAG -3'
Posted On 2016-12-15