Incidental Mutation 'R5795:Irf7'
ID 447175
Institutional Source Beutler Lab
Gene Symbol Irf7
Ensembl Gene ENSMUSG00000025498
Gene Name interferon regulatory factor 7
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 141262706-141266481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 141265116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 118 (P118L)
Ref Sequence ENSEMBL: ENSMUSP00000147529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000080654] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000209899] [ENSMUST00000210124] [ENSMUST00000210773] [ENSMUST00000155123] [ENSMUST00000167263]
AlphaFold P70434
Predicted Effect probably damaging
Transcript: ENSMUST00000026571
AA Change: P118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498
AA Change: P118L

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080654
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097952
AA Change: P118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498
AA Change: P118L

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106023
AA Change: P118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498
AA Change: P118L

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106027
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122143
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000123525
AA Change: P59L
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498
AA Change: P59L

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect probably benign
Transcript: ENSMUST00000142572
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect probably damaging
Transcript: ENSMUST00000209899
AA Change: P118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167263
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more vulnerable to viral infection and exhibit decreased serum interferon levels in response to viral infection. [provided by MGI curators]
Allele List at MGI

4 alleles

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Irf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Irf7 APN 7 141264640 missense probably benign 0.02
IGL03275:Irf7 APN 7 141265146 missense probably damaging 0.99
Houstonian UTSW 7 141264022 missense probably damaging 0.99
inept UTSW 7 141265140 missense probably damaging 1.00
R0593:Irf7 UTSW 7 141265062 unclassified probably benign
R1339:Irf7 UTSW 7 141263704 missense probably damaging 1.00
R1442:Irf7 UTSW 7 141264022 missense probably damaging 0.99
R4354:Irf7 UTSW 7 141265270 missense probably damaging 1.00
R4724:Irf7 UTSW 7 141264735 missense possibly damaging 0.92
R5444:Irf7 UTSW 7 141264819 unclassified probably benign
R7444:Irf7 UTSW 7 141263686 missense probably damaging 1.00
R7535:Irf7 UTSW 7 141264637 missense probably benign 0.10
R8357:Irf7 UTSW 7 141263281 missense possibly damaging 0.89
R8457:Irf7 UTSW 7 141263281 missense possibly damaging 0.89
R8683:Irf7 UTSW 7 141263509 missense probably null 1.00
R9166:Irf7 UTSW 7 141264753 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGCAGGAAGTGTGCACTC -3'
(R):5'- TTCAAGGTGGTACCCAGTCC -3'

Sequencing Primer
(F):5'- GAAGTGTGCACTCCCCCTC -3'
(R):5'- AGAACTCCTGGGGGAATCC -3'
Posted On 2016-12-15