Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Hephl1'

447179

Institutional Source

Beutler Lab

Gene Symbol

Hephl1

Ensembl Gene

ENSMUSG00000031936

Gene Name

hephaestin-like 1

Synonyms

LOC244698, zyklopen, Zp

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15051841-15112108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15069760 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 792 (G792E)

Ref Sequence

ENSEMBL: ENSMUSP00000124518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159985]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159985
AA Change: G792E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: G792E

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
Pfam:Cu-oxidase_3	97	209	2.8e-12	PFAM
Pfam:Cu-oxidase_2	289	365	2.4e-9	PFAM
Pfam:Cu-oxidase_3	452	564	1.2e-9	PFAM
Blast:FA58C	604	703	9e-9	BLAST
Pfam:Cu-oxidase_3	805	908	1.6e-7	PFAM
Pfam:Cu-oxidase_2	946	1067	9e-14	PFAM
transmembrane domain	1115	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hmmr	T	A	11: 40,721,906	D158V	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Lrp4	A	G	2: 91,474,471	D224G	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tanc1	A	G	2: 59,807,582	T876A	possibly damaging	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r104	G	T	17: 20,030,110	T633N	probably benign	Het
Vmn2r104	A	G	17: 20,030,282	S576P	possibly damaging	Het
Vmn2r105	A	T	17: 20,228,736	C60S	probably benign	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Hephl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Hephl1	APN	9	15067045	missense	probably benign	0.06
IGL01105:Hephl1	APN	9	15089024	missense	possibly damaging	0.95
IGL01731:Hephl1	APN	9	15069770	missense	probably damaging	1.00
IGL02010:Hephl1	APN	9	15090556	nonsense	probably null
IGL02112:Hephl1	APN	9	15081815	splice site	probably benign
IGL02227:Hephl1	APN	9	15069793	missense	probably damaging	1.00
IGL02490:Hephl1	APN	9	15053685	missense	probably benign	0.06
IGL02960:Hephl1	APN	9	15084319	missense	probably damaging	1.00
IGL03265:Hephl1	APN	9	15060959	missense	probably benign	0.14
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0007:Hephl1	UTSW	9	15086175	missense	possibly damaging	0.58
R0092:Hephl1	UTSW	9	15090603	frame shift	probably null
R0421:Hephl1	UTSW	9	15059160	missense	probably benign	0.05
R0448:Hephl1	UTSW	9	15076926	missense	probably damaging	1.00
R0563:Hephl1	UTSW	9	15081945	missense	probably damaging	1.00
R0602:Hephl1	UTSW	9	15089051	missense	probably damaging	0.99
R0631:Hephl1	UTSW	9	15084524	missense	probably benign	0.04
R0747:Hephl1	UTSW	9	15054001	splice site	probably benign
R1123:Hephl1	UTSW	9	15080140	missense	probably benign	0.00
R1386:Hephl1	UTSW	9	15076754	missense	probably benign
R1711:Hephl1	UTSW	9	15059246	missense	probably damaging	1.00
R1743:Hephl1	UTSW	9	15090068	missense	probably damaging	0.99
R1833:Hephl1	UTSW	9	15076928	missense	probably damaging	0.99
R1908:Hephl1	UTSW	9	15074124	nonsense	probably null
R1918:Hephl1	UTSW	9	15076818	missense	probably benign	0.16
R1938:Hephl1	UTSW	9	15053987	missense	possibly damaging	0.88
R1986:Hephl1	UTSW	9	15054552	missense	probably damaging	1.00
R3122:Hephl1	UTSW	9	15088969	missense	possibly damaging	0.90
R3832:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R3833:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R4280:Hephl1	UTSW	9	15112034	missense	probably benign	0.05
R4434:Hephl1	UTSW	9	15076796	missense	probably damaging	0.99
R4790:Hephl1	UTSW	9	15059171	missense	probably damaging	1.00
R4793:Hephl1	UTSW	9	15097990	missense	probably benign	0.34
R4960:Hephl1	UTSW	9	15086290	missense	probably damaging	1.00
R5125:Hephl1	UTSW	9	15086172	missense	probably damaging	0.98
R5152:Hephl1	UTSW	9	15080185	missense	probably damaging	1.00
R5178:Hephl1	UTSW	9	15086172	missense	probably damaging	0.98
R5288:Hephl1	UTSW	9	15076854	missense	possibly damaging	0.83
R5372:Hephl1	UTSW	9	15097899	nonsense	probably null
R5377:Hephl1	UTSW	9	15069788	missense	probably damaging	1.00
R5788:Hephl1	UTSW	9	15084283	missense	possibly damaging	0.93
R6210:Hephl1	UTSW	9	15090564	missense	possibly damaging	0.57
R6303:Hephl1	UTSW	9	15090152	missense	possibly damaging	0.69
R6394:Hephl1	UTSW	9	15074101	missense	probably benign	0.00
R6653:Hephl1	UTSW	9	15081964	missense	probably damaging	0.99
R6764:Hephl1	UTSW	9	15088921	missense	possibly damaging	0.88
R7114:Hephl1	UTSW	9	15069815	missense	probably damaging	0.96
R7143:Hephl1	UTSW	9	15060810	missense	possibly damaging	0.80
R7404:Hephl1	UTSW	9	15069751	missense	possibly damaging	0.84
R7446:Hephl1	UTSW	9	15098051	missense	probably damaging	1.00
R7447:Hephl1	UTSW	9	15097882	critical splice donor site	probably null
R7715:Hephl1	UTSW	9	15060785	missense	probably benign	0.36
R8013:Hephl1	UTSW	9	15054609	missense	possibly damaging	0.78
R8156:Hephl1	UTSW	9	15060914	missense	possibly damaging	0.77
X0026:Hephl1	UTSW	9	15084228	critical splice donor site	probably null
X0066:Hephl1	UTSW	9	15053668	missense	probably benign	0.00
Z1088:Hephl1	UTSW	9	15053721	missense	probably damaging	1.00
Z1177:Hephl1	UTSW	9	15090054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAGACACCAGGTAGACTGC -3'
(R):5'- TCTCAGAGATGGTGCAAAAGCC -3'

Sequencing Primer
(F):5'- AGGTAGACTGCCCTGAGGAC -3'
(R):5'- GATGGTGCAAAAGCCAACTC -3'

Posted On

2016-12-15