Incidental Mutation 'R5795:Chrna3'
ID 447181
Institutional Source Beutler Lab
Gene Symbol Chrna3
Ensembl Gene ENSMUSG00000032303
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms A730007P14Rik, Acra3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, alpha 3, (a)3, Acra-3
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 55010111-55026562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55015268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 419 (T419S)
Ref Sequence ENSEMBL: ENSMUSP00000150636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000214204]
AlphaFold Q8R4G9
Predicted Effect probably benign
Transcript: ENSMUST00000034851
AA Change: T419S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303
AA Change: T419S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214204
AA Change: T419S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation show high postnatal and postweaning mortality. Mutants show reduced bladder contractility resulting in enlarged bladder, infections and urinary stones. Eyes are small, with dilated ocular pupils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Chrna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Chrna3 APN 9 55016006 missense probably benign 0.01
IGL02484:Chrna3 APN 9 55015537 missense probably damaging 1.00
R0494:Chrna3 UTSW 9 55022278 missense probably damaging 1.00
R0538:Chrna3 UTSW 9 55016006 missense probably benign 0.01
R0557:Chrna3 UTSW 9 55015865 missense probably damaging 1.00
R0674:Chrna3 UTSW 9 55015172 missense probably damaging 1.00
R1552:Chrna3 UTSW 9 55015908 missense probably benign 0.16
R1750:Chrna3 UTSW 9 55016057 missense probably damaging 1.00
R2191:Chrna3 UTSW 9 55016045 missense probably damaging 1.00
R2989:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3114:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3153:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3154:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3434:Chrna3 UTSW 9 55024326 missense possibly damaging 0.95
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3733:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R4758:Chrna3 UTSW 9 55022276 missense probably damaging 1.00
R4903:Chrna3 UTSW 9 55015526 missense probably benign 0.01
R5430:Chrna3 UTSW 9 55012908 missense probably damaging 0.98
R6546:Chrna3 UTSW 9 55015901 missense probably damaging 1.00
R6806:Chrna3 UTSW 9 55015810 missense probably damaging 1.00
R7516:Chrna3 UTSW 9 55015369 missense probably benign 0.00
R7703:Chrna3 UTSW 9 55016124 missense probably benign 0.00
R8053:Chrna3 UTSW 9 55015390 missense probably benign 0.25
R8762:Chrna3 UTSW 9 55015711 missense probably damaging 1.00
R9170:Chrna3 UTSW 9 55026387 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGAGTCTAATTTTCTAACCTCTGCC -3'
(R):5'- TCTCCCCAGGGTCATGTTTATG -3'

Sequencing Primer
(F):5'- AATTTTCTAACCTCTGCCCTATGC -3'
(R):5'- TGTTTATGACTAGGCCAACCAGC -3'
Posted On 2016-12-15