Incidental Mutation 'R5795:Acpp'
ID 447182
Institutional Source Beutler Lab
Gene Symbol Acpp
Ensembl Gene ENSMUSG00000032561
Gene Name acid phosphatase, prostate
Synonyms A030005E02Rik, PAP
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 104288251-104337748 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104309489 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000108209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590]
AlphaFold Q8CE08
Predicted Effect probably benign
Transcript: ENSMUST00000062723
AA Change: V261A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561
AA Change: V261A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112590
AA Change: V261A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561
AA Change: V261A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194330
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Acpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acpp APN 9 104326948 missense probably damaging 1.00
IGL02994:Acpp APN 9 104309403 splice site probably benign
IGL03069:Acpp APN 9 104320005 missense possibly damaging 0.78
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0084:Acpp UTSW 9 104314365 missense probably benign 0.07
R0098:Acpp UTSW 9 104319945 splice site probably null
R0119:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0299:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0362:Acpp UTSW 9 104314427 missense probably damaging 1.00
R0499:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0514:Acpp UTSW 9 104319978 missense probably damaging 1.00
R0964:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R1506:Acpp UTSW 9 104324174 missense probably damaging 1.00
R1624:Acpp UTSW 9 104320001 missense probably benign 0.39
R2019:Acpp UTSW 9 104324702 missense probably damaging 1.00
R3821:Acpp UTSW 9 104324717 missense probably damaging 0.99
R3822:Acpp UTSW 9 104324717 missense probably damaging 0.99
R4896:Acpp UTSW 9 104306975 missense probably damaging 1.00
R5084:Acpp UTSW 9 104326917 missense probably damaging 1.00
R5257:Acpp UTSW 9 104309475 missense probably benign 0.24
R5258:Acpp UTSW 9 104309475 missense probably benign 0.24
R5519:Acpp UTSW 9 104291488 missense probably damaging 1.00
R6909:Acpp UTSW 9 104300965 missense probably damaging 1.00
R7315:Acpp UTSW 9 104316224 critical splice donor site probably null
R7349:Acpp UTSW 9 104291458 missense probably benign 0.01
R7792:Acpp UTSW 9 104326966 missense probably damaging 1.00
R8355:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R8455:Acpp UTSW 9 104326975 missense possibly damaging 0.94
Z1177:Acpp UTSW 9 104314418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTAACTTCCACCAGGG -3'
(R):5'- GATGCCTCTGAGTTTCAGCTC -3'

Sequencing Primer
(F):5'- TGTAACTTCCACCAGGGCAGAAAG -3'
(R):5'- TCTGAGTTTCAGCTCCACAAGAC -3'
Posted On 2016-12-15