Incidental Mutation 'R5795:Ilvbl'
ID 447185
Institutional Source Beutler Lab
Gene Symbol Ilvbl
Ensembl Gene ENSMUSG00000032763
Gene Name ilvB (bacterial acetolactate synthase)-like
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 78574346-78584502 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78577144 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000151521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105384] [ENSMUST00000218061] [ENSMUST00000218215] [ENSMUST00000218271] [ENSMUST00000218763] [ENSMUST00000218787] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
AlphaFold Q8BU33
Predicted Effect probably benign
Transcript: ENSMUST00000105384
AA Change: S167P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763
AA Change: S167P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218061
Predicted Effect probably benign
Transcript: ENSMUST00000218215
AA Change: S167P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000218271
AA Change: S167P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000218763
Predicted Effect probably benign
Transcript: ENSMUST00000218787
Predicted Effect probably benign
Transcript: ENSMUST00000218875
AA Change: S167P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000218885
AA Change: S167P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect unknown
Transcript: ENSMUST00000219588
AA Change: S38P
Predicted Effect probably benign
Transcript: ENSMUST00000220430
AA Change: S167P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Ilvbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ilvbl APN 10 78583905 missense probably damaging 1.00
IGL00962:Ilvbl APN 10 78583338 missense possibly damaging 0.95
IGL01655:Ilvbl APN 10 78577333 splice site probably benign
IGL01657:Ilvbl APN 10 78576768 missense possibly damaging 0.57
IGL01682:Ilvbl APN 10 78577107 splice site probably benign
IGL01768:Ilvbl APN 10 78583293 missense possibly damaging 0.80
IGL01982:Ilvbl APN 10 78579022 missense probably damaging 1.00
IGL02207:Ilvbl APN 10 78583702 critical splice donor site probably null
IGL02561:Ilvbl APN 10 78577144 missense probably benign 0.01
IGL02985:Ilvbl APN 10 78579067 missense probably benign 0.00
R0398:Ilvbl UTSW 10 78579539 missense probably damaging 0.99
R0557:Ilvbl UTSW 10 78583487 nonsense probably null
R0562:Ilvbl UTSW 10 78583487 missense probably damaging 1.00
R0583:Ilvbl UTSW 10 78583267 missense probably damaging 0.99
R1381:Ilvbl UTSW 10 78576596 missense probably damaging 1.00
R1484:Ilvbl UTSW 10 78576730 missense probably damaging 1.00
R1537:Ilvbl UTSW 10 78579731 missense probably benign 0.31
R1862:Ilvbl UTSW 10 78584124 missense probably benign 0.00
R2474:Ilvbl UTSW 10 78576724 missense probably damaging 1.00
R2876:Ilvbl UTSW 10 78583056 missense probably benign
R3621:Ilvbl UTSW 10 78577180 missense probably damaging 1.00
R3811:Ilvbl UTSW 10 78579035 missense probably benign
R4591:Ilvbl UTSW 10 78583305 missense probably benign 0.01
R5040:Ilvbl UTSW 10 78583318 missense probably damaging 1.00
R5449:Ilvbl UTSW 10 78577028 critical splice donor site probably null
R5910:Ilvbl UTSW 10 78577113 missense probably benign
R6746:Ilvbl UTSW 10 78577223 missense possibly damaging 0.48
R7019:Ilvbl UTSW 10 78579086 missense probably damaging 0.96
R7223:Ilvbl UTSW 10 78583696 missense probably benign 0.31
R7494:Ilvbl UTSW 10 78579023 missense possibly damaging 0.76
R7576:Ilvbl UTSW 10 78583697 missense possibly damaging 0.45
R7727:Ilvbl UTSW 10 78576666 missense probably benign 0.00
R7777:Ilvbl UTSW 10 78577251 critical splice donor site probably null
R7800:Ilvbl UTSW 10 78583975 missense possibly damaging 0.48
R8082:Ilvbl UTSW 10 78584153 missense probably damaging 0.98
R8697:Ilvbl UTSW 10 78583362 nonsense probably null
Z1177:Ilvbl UTSW 10 78581124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGCAGTGAAGAATGCAC -3'
(R):5'- ACAAACACTGGACCTGCAGG -3'

Sequencing Primer
(F):5'- TGCACAAGTGGCACAGTC -3'
(R):5'- GAGGTTCAGTCTATGGCACC -3'
Posted On 2016-12-15