Incidental Mutation 'R5795:Ankrd24'
ID 447186
Institutional Source Beutler Lab
Gene Symbol Ankrd24
Ensembl Gene ENSMUSG00000054708
Gene Name ankyrin repeat domain 24
Synonyms 4631433D01Rik, 5730519E19Rik, D10Bur2e
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock # R5795 (G1)
Quality Score 223
Status Not validated
Chromosome 10
Chromosomal Location 81628540-81647610 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 81645103 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119336] [ENSMUST00000123993] [ENSMUST00000189672]
AlphaFold Q80VM7
Predicted Effect probably benign
Transcript: ENSMUST00000119336
SMART Domains Protein: ENSMUSP00000112932
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
Blast:ANK 18 48 1e-6 BLAST
ANK 52 81 2.92e-2 SMART
ANK 85 114 7.53e-5 SMART
ANK 118 149 4.07e-1 SMART
ANK 151 180 2.92e-2 SMART
ANK 184 213 3.97e-4 SMART
low complexity region 240 250 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
internal_repeat_2 488 606 4.87e-8 PROSPERO
internal_repeat_2 597 713 4.87e-8 PROSPERO
low complexity region 718 736 N/A INTRINSIC
coiled coil region 747 895 N/A INTRINSIC
Blast:ANK 950 977 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123305
Predicted Effect probably benign
Transcript: ENSMUST00000123993
SMART Domains Protein: ENSMUSP00000117975
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ANK 48 78 2e-8 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000132458
AA Change: A73D
SMART Domains Protein: ENSMUSP00000121709
Gene: ENSMUSG00000054708
AA Change: A73D

DomainStartEndE-ValueType
coiled coil region 1 94 N/A INTRINSIC
Blast:ANK 142 175 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154707
Predicted Effect probably benign
Transcript: ENSMUST00000189672
SMART Domains Protein: ENSMUSP00000140398
Gene: ENSMUSG00000096856

DomainStartEndE-ValueType
KRAB 4 66 1.5e-18 SMART
ZnF_C2H2 104 126 6.4e-6 SMART
ZnF_C2H2 132 154 4.4e-8 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 3.5e-6 SMART
ZnF_C2H2 216 238 2.9e-6 SMART
ZnF_C2H2 244 266 3e-5 SMART
ZnF_C2H2 272 294 7.7e-6 SMART
ZnF_C2H2 300 322 2e-5 SMART
ZnF_C2H2 328 350 1.4e-6 SMART
ZnF_C2H2 356 378 1.4e-4 SMART
ZnF_C2H2 384 406 9.4e-6 SMART
ZnF_C2H2 412 434 4.3e-5 SMART
ZnF_C2H2 440 462 2e-6 SMART
ZnF_C2H2 468 490 3.7e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Ankrd24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Ankrd24 APN 10 81643145 unclassified probably benign
IGL00809:Ankrd24 APN 10 81643067 unclassified probably benign
IGL01021:Ankrd24 APN 10 81635161 splice site probably null
IGL01073:Ankrd24 APN 10 81639322 missense possibly damaging 0.76
IGL01875:Ankrd24 APN 10 81629737 unclassified probably benign
IGL03083:Ankrd24 APN 10 81638649 missense probably benign
IGL03335:Ankrd24 APN 10 81647133 missense probably benign 0.18
R0129:Ankrd24 UTSW 10 81638329 missense probably damaging 1.00
R0243:Ankrd24 UTSW 10 81634944 missense probably damaging 1.00
R0522:Ankrd24 UTSW 10 81636355 splice site probably benign
R0607:Ankrd24 UTSW 10 81638308 missense probably damaging 0.98
R0707:Ankrd24 UTSW 10 81642713 unclassified probably benign
R1472:Ankrd24 UTSW 10 81634920 missense probably damaging 1.00
R1766:Ankrd24 UTSW 10 81638638 missense probably benign 0.13
R1852:Ankrd24 UTSW 10 81642941 unclassified probably benign
R1891:Ankrd24 UTSW 10 81643508 unclassified probably benign
R2137:Ankrd24 UTSW 10 81646309 missense probably damaging 1.00
R3790:Ankrd24 UTSW 10 81642679 unclassified probably benign
R4798:Ankrd24 UTSW 10 81643315 unclassified probably benign
R4952:Ankrd24 UTSW 10 81647148 missense probably benign 0.01
R5068:Ankrd24 UTSW 10 81639865 missense possibly damaging 0.87
R5237:Ankrd24 UTSW 10 81642545 unclassified probably benign
R5418:Ankrd24 UTSW 10 81644942 unclassified probably benign
R7188:Ankrd24 UTSW 10 81636390 nonsense probably null
R7614:Ankrd24 UTSW 10 81638689 missense unknown
R7750:Ankrd24 UTSW 10 81646794 missense possibly damaging 0.72
R8004:Ankrd24 UTSW 10 81638357 missense unknown
R8190:Ankrd24 UTSW 10 81638318 missense unknown
R8415:Ankrd24 UTSW 10 81640113 missense unknown
R8670:Ankrd24 UTSW 10 81629692 start gained probably benign
R8898:Ankrd24 UTSW 10 81642518 missense unknown
RF001:Ankrd24 UTSW 10 81643571 unclassified probably benign
RF011:Ankrd24 UTSW 10 81643571 unclassified probably benign
RF037:Ankrd24 UTSW 10 81643573 nonsense probably null
RF061:Ankrd24 UTSW 10 81643567 nonsense probably null
Z1088:Ankrd24 UTSW 10 81638656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAAGCCACTTTGGGGTC -3'
(R):5'- GGTTACCATTGCATATCAACACC -3'

Sequencing Primer
(F):5'- CCAAGCCACTTTGGGGTCTAAATG -3'
(R):5'- CCAAAAGTGAATCTGCTGAGACTTTC -3'
Posted On 2016-12-15