Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Hmmr'

447188

Institutional Source

Beutler Lab

Gene Symbol

Hmmr

Ensembl Gene

ENSMUSG00000020330

Gene Name

hyaluronan mediated motility receptor (RHAMM)

Synonyms

CD168, Rhamm

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40701395-40733422 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40721906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 158 (D158V)

Ref Sequence

ENSEMBL: ENSMUSP00000020579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020579]

AlphaFold

Q00547

Predicted Effect

probably damaging
Transcript: ENSMUST00000020579
AA Change: D158V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: D158V

Domain	Start	End	E-Value	Type
Pfam:HMMR_N	15	339	1.2e-136	PFAM
low complexity region	375	385	N/A	INTRINSIC
low complexity region	430	442	N/A	INTRINSIC
Blast:MA	452	578	7e-6	BLAST
Pfam:HMMR_C	636	789	4.3e-71	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127705

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152749

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156399

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hephl1	C	T	9: 15,069,760	G792E	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Lrp4	A	G	2: 91,474,471	D224G	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tanc1	A	G	2: 59,807,582	T876A	possibly damaging	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r104	G	T	17: 20,030,110	T633N	probably benign	Het
Vmn2r104	A	G	17: 20,030,282	S576P	possibly damaging	Het
Vmn2r105	A	T	17: 20,228,736	C60S	probably benign	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Hmmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01795:Hmmr	APN	11	40721734	missense	probably benign	0.25
IGL02096:Hmmr	APN	11	40707429	missense	probably benign	0.02
IGL02224:Hmmr	APN	11	40710004	missense	unknown
IGL02527:Hmmr	APN	11	40708105	missense	probably damaging	1.00
IGL02870:Hmmr	APN	11	40714075	missense	possibly damaging	0.63
IGL03175:Hmmr	APN	11	40714809	missense	probably benign	0.02
IGL03327:Hmmr	APN	11	40715415	missense	probably damaging	1.00
R0126:Hmmr	UTSW	11	40705954	missense	probably damaging	1.00
R0211:Hmmr	UTSW	11	40714808	missense	probably damaging	0.96
R0533:Hmmr	UTSW	11	40709989	missense	unknown
R0610:Hmmr	UTSW	11	40715902	missense	probably damaging	1.00
R0747:Hmmr	UTSW	11	40721745	splice site	probably benign
R1909:Hmmr	UTSW	11	40708098	missense	probably damaging	1.00
R2013:Hmmr	UTSW	11	40728432	missense	possibly damaging	0.85
R4446:Hmmr	UTSW	11	40715321	missense	probably damaging	1.00
R4897:Hmmr	UTSW	11	40728434	missense	probably benign	0.00
R4937:Hmmr	UTSW	11	40721840	missense	possibly damaging	0.90
R5873:Hmmr	UTSW	11	40707700	missense	probably damaging	0.99
R6414:Hmmr	UTSW	11	40715867	critical splice donor site	probably null
R6962:Hmmr	UTSW	11	40707415	missense	probably damaging	1.00
R7391:Hmmr	UTSW	11	40707786	splice site	probably null
R7558:Hmmr	UTSW	11	40733329	missense	probably damaging	1.00
R7965:Hmmr	UTSW	11	40715429	splice site	probably null
R8065:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8066:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8255:Hmmr	UTSW	11	40707435	missense	probably damaging	1.00
R8303:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8304:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8306:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8307:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8308:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8387:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8743:Hmmr	UTSW	11	40708031	missense	probably damaging	1.00
R8817:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8820:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8829:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8831:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8838:Hmmr	UTSW	11	40714027	missense	probably benign	0.00
R9312:Hmmr	UTSW	11	40723489	missense	possibly damaging	0.77
T0975:Hmmr	UTSW	11	40723416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGACCATCATACTCTGCACAAC -3'
(R):5'- TGACAGGCACAGTACTCAGTC -3'

Sequencing Primer
(F):5'- GCACAACACAGAGAACTATTTTAGG -3'
(R):5'- AGGCACAGTACTCAGTCATGTGTC -3'

Posted On

2016-12-15