Incidental Mutation 'R5795:Zfp456'
ID 447190
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Name zinc finger protein 456
Synonyms Rslcan-13
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 67362113-67375810 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67366920 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 222 (D222E)
Ref Sequence ENSEMBL: ENSMUSP00000059686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266]
AlphaFold B2RUK9
Predicted Effect probably benign
Transcript: ENSMUST00000057070
AA Change: D222E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: D222E

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165145
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172266
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R2896:Zfp456 UTSW 13 67367297 missense possibly damaging 0.52
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R4971:Zfp456 UTSW 13 67366876 missense probably benign 0.31
R5357:Zfp456 UTSW 13 67372209 missense possibly damaging 0.71
R5754:Zfp456 UTSW 13 67366240 missense probably benign 0.40
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R6904:Zfp456 UTSW 13 67366265 missense probably benign 0.44
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
R7690:Zfp456 UTSW 13 67366794 missense probably damaging 1.00
R8228:Zfp456 UTSW 13 67366414 missense probably damaging 1.00
R8410:Zfp456 UTSW 13 67372796 missense probably damaging 1.00
R8507:Zfp456 UTSW 13 67366989 missense probably damaging 1.00
R8745:Zfp456 UTSW 13 67367254 missense possibly damaging 0.77
R8928:Zfp456 UTSW 13 67366484 missense probably benign 0.00
R9331:Zfp456 UTSW 13 67366270 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTCTTCACACTTGTAGGG -3'
(R):5'- TTTGGCTCAACAGGAATAAAACCC -3'

Sequencing Primer
(F):5'- GATGAGGAAAAACATTTGCCACACTC -3'
(R):5'- GAGTGTCATAAGGCCTTCAGTACTC -3'
Posted On 2016-12-15