Incidental Mutation 'R5795:Vmn2r104'
ID447195
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Namevomeronasal 2, receptor 104
SynonymsV2r7
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5795 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20029425-20048205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20030110 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 633 (T633N)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
Predicted Effect probably benign
Transcript: ENSMUST00000168050
AA Change: T633N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: T633N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGATCAGTGTGCAGATAG -3'
(R):5'- ATCTGTGAGCTTTCTGGCC -3'

Sequencing Primer
(F):5'- AGGAATGATGTATCTTGGACCCC -3'
(R):5'- GAGCTTTCTGGCCTATGAAGACC -3'
Posted On2016-12-15