Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Vmn2r104'

447195

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R5795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20030110 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 633 (T633N)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

Predicted Effect

probably benign
Transcript: ENSMUST00000168050
AA Change: T633N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: T633N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hephl1	C	T	9: 15,069,760	G792E	probably damaging	Het
Hmmr	T	A	11: 40,721,906	D158V	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Lrp4	A	G	2: 91,474,471	D224G	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tanc1	A	G	2: 59,807,582	T876A	possibly damaging	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r105	A	T	17: 20,228,736	C60S	probably benign	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGATCAGTGTGCAGATAG -3'
(R):5'- ATCTGTGAGCTTTCTGGCC -3'

Sequencing Primer
(F):5'- AGGAATGATGTATCTTGGACCCC -3'
(R):5'- GAGCTTTCTGGCCTATGAAGACC -3'

Posted On

2016-12-15