Incidental Mutation 'R5795:Vmn2r104'
ID 447196
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
MMRRC Submission 043386-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20249687-20268467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20250544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 576 (S576P)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000168050
AA Change: S576P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: S576P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp3 A G 9: 104,186,688 (GRCm39) V261A probably benign Het
Adipor1 C A 1: 134,352,641 (GRCm39) N137K probably damaging Het
Ahnak A T 19: 8,989,746 (GRCm39) K3677* probably null Het
Ankrd24 C A 10: 81,480,937 (GRCm39) probably benign Het
Appl1 G T 14: 26,664,773 (GRCm39) P420Q probably benign Het
Bmp8b C A 4: 123,015,761 (GRCm39) F249L possibly damaging Het
Brat1 G T 5: 140,698,827 (GRCm39) A275S probably benign Het
C5ar1 T C 7: 15,982,319 (GRCm39) K234E possibly damaging Het
Cblif A G 19: 11,737,740 (GRCm39) T384A probably damaging Het
Ccs A G 19: 4,883,367 (GRCm39) probably null Het
Chmp5 T G 4: 40,950,562 (GRCm39) probably null Het
Chrna3 T A 9: 54,922,552 (GRCm39) T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 140,769,118 (GRCm39) probably null Het
Csf3 G T 11: 98,592,853 (GRCm39) C72F probably damaging Het
Dbndd1 A G 8: 124,236,619 (GRCm39) I83T probably damaging Het
Ercc6 A G 14: 32,248,309 (GRCm39) K287E probably damaging Het
F5 C T 1: 163,979,578 (GRCm39) T16I probably benign Het
Hephl1 C T 9: 14,981,056 (GRCm39) G792E probably damaging Het
Hmmr T A 11: 40,612,733 (GRCm39) D158V probably damaging Het
Hsd11b1 A G 1: 192,922,940 (GRCm39) S76P possibly damaging Het
Ilvbl T C 10: 78,412,978 (GRCm39) S167P probably benign Het
Irf7 G A 7: 140,845,029 (GRCm39) P118L probably damaging Het
Lama1 A G 17: 68,103,722 (GRCm39) N1981S probably benign Het
Lrp4 A G 2: 91,304,816 (GRCm39) D224G probably benign Het
Mink1 T C 11: 70,498,616 (GRCm39) Y594H possibly damaging Het
Minpp1 G A 19: 32,491,557 (GRCm39) V412M probably damaging Het
Muc5b G A 7: 141,425,478 (GRCm39) V4708M possibly damaging Het
Mycl G A 4: 122,890,415 (GRCm39) E34K probably damaging Het
Oaf T A 9: 43,135,241 (GRCm39) D179V probably damaging Het
Ogfod2 G A 5: 124,252,824 (GRCm39) G278D probably damaging Het
Or2h1 A G 17: 37,404,661 (GRCm39) L35P probably damaging Het
Or5b12 A G 19: 12,897,188 (GRCm39) F162L possibly damaging Het
Paf1 T G 7: 28,096,043 (GRCm39) M250R probably damaging Het
Pcdh8 T C 14: 80,008,420 (GRCm39) T48A possibly damaging Het
Pdzph1 A G 17: 59,192,862 (GRCm39) V1096A possibly damaging Het
Polr3b T C 10: 84,512,875 (GRCm39) S586P probably damaging Het
Polr3b A T 10: 84,464,116 (GRCm39) E25D probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Slc28a2b T C 2: 122,348,475 (GRCm39) M274T possibly damaging Het
Slc31a2 T C 4: 62,215,289 (GRCm39) V112A probably damaging Het
Spire1 A T 18: 67,628,265 (GRCm39) S412T probably benign Het
Tanc1 A G 2: 59,637,926 (GRCm39) T876A possibly damaging Het
Tango6 T A 8: 107,444,709 (GRCm39) L538H probably damaging Het
Tas2r125 G A 6: 132,886,621 (GRCm39) G3D probably damaging Het
Tbc1d32 A T 10: 56,091,158 (GRCm39) M125K possibly damaging Het
Traf5 T C 1: 191,731,807 (GRCm39) S345G probably benign Het
Ush2a A T 1: 188,175,594 (GRCm39) I1231F probably benign Het
Vmn2r105 A T 17: 20,448,998 (GRCm39) C60S probably benign Het
Zfp316 A T 5: 143,248,594 (GRCm39) D217E unknown Het
Zfp456 A T 13: 67,515,039 (GRCm39) D222E probably benign Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20,258,501 (GRCm39) missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20,268,358 (GRCm39) missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20,263,055 (GRCm39) missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20,263,158 (GRCm39) missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20,260,930 (GRCm39) missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20,250,187 (GRCm39) missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20,262,056 (GRCm39) nonsense probably null
IGL02305:Vmn2r104 APN 17 20,263,118 (GRCm39) missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20,263,048 (GRCm39) missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20,263,083 (GRCm39) missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20,249,866 (GRCm39) missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20,262,075 (GRCm39) missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20,250,069 (GRCm39) missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20,249,889 (GRCm39) missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20,268,264 (GRCm39) nonsense probably null
R0709:Vmn2r104 UTSW 17 20,263,166 (GRCm39) missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20,262,987 (GRCm39) missense probably benign
R1575:Vmn2r104 UTSW 17 20,262,477 (GRCm39) missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20,262,497 (GRCm39) missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20,261,031 (GRCm39) missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20,262,313 (GRCm39) missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20,268,455 (GRCm39) missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20,249,818 (GRCm39) missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20,250,183 (GRCm39) missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20,250,147 (GRCm39) missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20,262,503 (GRCm39) missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20,268,443 (GRCm39) missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20,261,030 (GRCm39) nonsense probably null
R4911:Vmn2r104 UTSW 17 20,250,288 (GRCm39) missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20,258,528 (GRCm39) missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20,262,146 (GRCm39) missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20,250,163 (GRCm39) missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20,250,450 (GRCm39) missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20,250,343 (GRCm39) missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20,260,981 (GRCm39) nonsense probably null
R5795:Vmn2r104 UTSW 17 20,250,372 (GRCm39) missense probably benign 0.02
R5970:Vmn2r104 UTSW 17 20,249,733 (GRCm39) missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20,261,970 (GRCm39) missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20,249,747 (GRCm39) missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20,258,573 (GRCm39) missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20,261,909 (GRCm39) missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20,250,507 (GRCm39) missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20,261,829 (GRCm39) missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20,249,848 (GRCm39) missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20,262,487 (GRCm39) missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20,250,358 (GRCm39) missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20,261,088 (GRCm39) missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20,249,737 (GRCm39) missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20,249,791 (GRCm39) missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20,261,971 (GRCm39) missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8031:Vmn2r104 UTSW 17 20,263,048 (GRCm39) missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20,250,483 (GRCm39) missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20,250,465 (GRCm39) missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20,261,040 (GRCm39) missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20,262,110 (GRCm39) missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8900:Vmn2r104 UTSW 17 20,261,924 (GRCm39) missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20,249,968 (GRCm39) missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20,262,097 (GRCm39) missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20,261,098 (GRCm39) missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20,268,433 (GRCm39) missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20,250,250 (GRCm39) missense probably damaging 0.99
R9785:Vmn2r104 UTSW 17 20,268,409 (GRCm39) missense probably benign
RF007:Vmn2r104 UTSW 17 20,268,302 (GRCm39) missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20,250,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGTGGTCTGCTGAAGG -3'
(R):5'- TGACGTTTGTGATAGTCCCTAC -3'

Sequencing Primer
(F):5'- GCTGACCAATGAAGTTCAAAGAAC -3'
(R):5'- ACGTTTGTGATAGTCCCTACAGTTAG -3'
Posted On 2016-12-15