Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Vmn2r105'

447197

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r105

Ensembl Gene

ENSMUSG00000091670

Gene Name

vomeronasal 2, receptor 105

Synonyms

EG627743

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20208230-20234872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20228736 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 60 (C60S)

Ref Sequence

ENSEMBL: ENSMUSP00000129762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167382]

Predicted Effect

probably benign
Transcript: ENSMUST00000167382
AA Change: C60S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: C60S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	85	469	6.5e-42	PFAM
Pfam:NCD3G	512	565	3.2e-21	PFAM
Pfam:7tm_3	598	833	2.5e-51	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hephl1	C	T	9: 15,069,760	G792E	probably damaging	Het
Hmmr	T	A	11: 40,721,906	D158V	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Lrp4	A	G	2: 91,474,471	D224G	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tanc1	A	G	2: 59,807,582	T876A	possibly damaging	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r104	G	T	17: 20,030,110	T633N	probably benign	Het
Vmn2r104	A	G	17: 20,030,282	S576P	possibly damaging	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Vmn2r105

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Vmn2r105	APN	17	20228555	missense	probably benign	0.01
IGL01909:Vmn2r105	APN	17	20224656	missense	probably damaging	1.00
IGL01925:Vmn2r105	APN	17	20208711	missense	possibly damaging	0.94
IGL02021:Vmn2r105	APN	17	20227895	missense	possibly damaging	0.49
IGL02828:Vmn2r105	APN	17	20209083	missense	possibly damaging	0.80
IGL02838:Vmn2r105	APN	17	20227585	missense	probably damaging	1.00
IGL03343:Vmn2r105	APN	17	20226369	nonsense	probably null
R0096:Vmn2r105	UTSW	17	20227479	missense	possibly damaging	0.49
R0096:Vmn2r105	UTSW	17	20227479	missense	possibly damaging	0.49
R0212:Vmn2r105	UTSW	17	20208565	missense	possibly damaging	0.90
R0268:Vmn2r105	UTSW	17	20208676	missense	probably benign	0.18
R0271:Vmn2r105	UTSW	17	20234703	missense	probably damaging	0.96
R0613:Vmn2r105	UTSW	17	20208316	missense	probably damaging	1.00
R0765:Vmn2r105	UTSW	17	20227711	missense	probably benign	0.20
R0765:Vmn2r105	UTSW	17	20227857	missense	probably damaging	0.98
R1162:Vmn2r105	UTSW	17	20227711	missense	probably benign	0.20
R1263:Vmn2r105	UTSW	17	20208322	missense	probably damaging	1.00
R1363:Vmn2r105	UTSW	17	20208670	missense	probably benign	0.00
R1464:Vmn2r105	UTSW	17	20228742	splice site	probably benign
R2029:Vmn2r105	UTSW	17	20224578	missense	probably damaging	0.99
R2420:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2421:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2422:Vmn2r105	UTSW	17	20227835	missense	probably benign	0.15
R2570:Vmn2r105	UTSW	17	20227323	missense	probably damaging	1.00
R3847:Vmn2r105	UTSW	17	20208690	missense	possibly damaging	0.85
R3848:Vmn2r105	UTSW	17	20208690	missense	possibly damaging	0.85
R4030:Vmn2r105	UTSW	17	20208754	missense	probably damaging	0.99
R4275:Vmn2r105	UTSW	17	20228640	missense	probably damaging	1.00
R4551:Vmn2r105	UTSW	17	20226351	missense	probably benign
R4801:Vmn2r105	UTSW	17	20227294	missense	probably benign	0.00
R4802:Vmn2r105	UTSW	17	20227294	missense	probably benign	0.00
R4816:Vmn2r105	UTSW	17	20208691	missense	probably benign	0.27
R4929:Vmn2r105	UTSW	17	20228018	missense	probably benign	0.44
R5022:Vmn2r105	UTSW	17	20208414	missense	probably damaging	0.99
R5475:Vmn2r105	UTSW	17	20234782	missense	probably benign
R5576:Vmn2r105	UTSW	17	20224574	critical splice donor site	probably null
R5895:Vmn2r105	UTSW	17	20228667	missense	probably benign	0.10
R6017:Vmn2r105	UTSW	17	20208627	missense	probably damaging	0.97
R6210:Vmn2r105	UTSW	17	20228496	missense	probably damaging	1.00
R6491:Vmn2r105	UTSW	17	20227730	nonsense	probably null
R6542:Vmn2r105	UTSW	17	20228541	missense	probably benign	0.03
R6729:Vmn2r105	UTSW	17	20208343	missense	probably damaging	0.99
R7020:Vmn2r105	UTSW	17	20209074	missense	probably damaging	1.00
R7033:Vmn2r105	UTSW	17	20208612	missense	probably damaging	0.97
R7488:Vmn2r105	UTSW	17	20208783	missense	probably damaging	1.00
R7491:Vmn2r105	UTSW	17	20228565	missense	probably benign	0.02
R7555:Vmn2r105	UTSW	17	20227675	missense	probably damaging	0.98
R7863:Vmn2r105	UTSW	17	20208675	missense	probably benign	0.18
R8137:Vmn2r105	UTSW	17	20234704	missense	probably benign	0.02
R8166:Vmn2r105	UTSW	17	20208642	missense	probably benign	0.07
R8186:Vmn2r105	UTSW	17	20224618	nonsense	probably null
R8214:Vmn2r105	UTSW	17	20228513	missense	probably benign	0.02
R8497:Vmn2r105	UTSW	17	20234872	start codon destroyed	probably null	0.75

Predicted Primers

PCR Primer
(F):5'- GTCCTTCTCAGTGAATCTGACATTG -3'
(R):5'- AACCAATAACTTGTAGCAGCAGATC -3'

Sequencing Primer
(F):5'- CAGTGAATCTGACATTGTAGAAATCG -3'
(R):5'- GTAGACAGTTTTTATTTGACTTGCC -3'

Posted On

2016-12-15