Incidental Mutation 'R5795:Olfr91'
ID 447198
Institutional Source Beutler Lab
Gene Symbol Olfr91
Ensembl Gene ENSMUSG00000095377
Gene Name olfactory receptor 91
Synonyms MOR256-20, GA_x6K02T2PSCP-1533927-1532989
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37090618-37098278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37093769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 35 (L35P)
Ref Sequence ENSEMBL: ENSMUSP00000150298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087144] [ENSMUST00000216376] [ENSMUST00000217372]
AlphaFold Q7TRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000087144
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129446
Gene: ENSMUSG00000095377
AA Change: L35P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 4.8e-7 PFAM
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 2.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216376
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217372
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Olfr91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Olfr91 APN 17 37093332 missense probably benign 0.00
IGL03352:Olfr91 APN 17 37093419 missense probably benign 0.06
R0506:Olfr91 UTSW 17 37093311 missense probably damaging 1.00
R1980:Olfr91 UTSW 17 37093403 missense probably damaging 1.00
R1982:Olfr91 UTSW 17 37093808 missense probably damaging 0.98
R4941:Olfr91 UTSW 17 37093592 missense probably damaging 1.00
R5160:Olfr91 UTSW 17 37093724 missense possibly damaging 0.83
R6484:Olfr91 UTSW 17 37093266 missense probably benign
R6710:Olfr91 UTSW 17 37093746 missense probably damaging 1.00
R6838:Olfr91 UTSW 17 37093166 nonsense probably null
R8439:Olfr91 UTSW 17 37093772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGTCAGGAGGATGCAC -3'
(R):5'- CACAACGTCAGGACACATTG -3'

Sequencing Primer
(F):5'- ATGCACTCGGTGGTTCCCAAG -3'
(R):5'- CGTCAGGACACATTGAATCATG -3'
Posted On 2016-12-15