Incidental Mutation 'R5795:Gif'
ID 447204
Institutional Source Beutler Lab
Gene Symbol Gif
Ensembl Gene ENSMUSG00000024682
Gene Name gastric intrinsic factor
Synonyms
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5795 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 11747554-11763447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11760376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 384 (T384A)
Ref Sequence ENSEMBL: ENSMUSP00000025585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025585]
AlphaFold P52787
Predicted Effect probably damaging
Transcript: ENSMUST00000025585
AA Change: T384A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025585
Gene: ENSMUSG00000024682
AA Change: T384A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 8 308 2.6e-110 PFAM
Pfam:DUF4430 340 416 7.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cobalamin transport protein family. It encodes a glycoprotein secreted by parietal cells of the gastric mucosa and is required for adequate absorption of vitamin B12. Vitamin B12 is necessary for erythrocyte maturation and mutations in this gene may lead to congenital pernicious anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit vitamin B12-sensitive susceptibility to bacterial infection and reduced body weight and altered blood chemistry that can be compensated by maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Csf3 G T 11: 98,702,027 C72F probably damaging Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Gif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Gif APN 19 11757762 missense probably benign 0.40
IGL02466:Gif APN 19 11752232 missense probably damaging 1.00
IGL02678:Gif APN 19 11748475 missense probably damaging 1.00
IGL02955:Gif APN 19 11747663 missense possibly damaging 0.93
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0135:Gif UTSW 19 11757754 missense probably damaging 1.00
R0606:Gif UTSW 19 11752294 missense possibly damaging 0.80
R1758:Gif UTSW 19 11757815 missense probably damaging 1.00
R1885:Gif UTSW 19 11752324 missense probably benign
R2054:Gif UTSW 19 11759006 missense probably benign 0.01
R3087:Gif UTSW 19 11760373 nonsense probably null
R4004:Gif UTSW 19 11759007 missense probably damaging 1.00
R4601:Gif UTSW 19 11752190 missense probably damaging 1.00
R4888:Gif UTSW 19 11752219 missense probably benign 0.16
R5546:Gif UTSW 19 11748495 missense possibly damaging 0.95
R6136:Gif UTSW 19 11750285 missense probably damaging 0.98
R6147:Gif UTSW 19 11747572 start gained probably benign
R7342:Gif UTSW 19 11763223 missense probably benign 0.00
R7814:Gif UTSW 19 11750187 missense probably benign 0.14
R8382:Gif UTSW 19 11749726 missense probably benign 0.15
R8792:Gif UTSW 19 11750235 missense probably damaging 1.00
R9227:Gif UTSW 19 11760384 nonsense probably null
R9230:Gif UTSW 19 11760384 nonsense probably null
R9428:Gif UTSW 19 11757738 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATGATTCCATACACACTAGGC -3'
(R):5'- ATTTACAACACTCAATTCCTGTACC -3'

Sequencing Primer
(F):5'- GATTCCATACACACTAGGCATTTG -3'
(R):5'- TCCTGTACCTACCCTTATTATAAGC -3'
Posted On 2016-12-15