Incidental Mutation 'R5796:Rtel1'
ID447212
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 043387-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181340506 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 350 (E350K)
Ref Sequence ENSEMBL: ENSMUSP00000104443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
Predicted Effect probably benign
Transcript: ENSMUST00000048608
AA Change: E350K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: E350K

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: E350K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: E350K

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: E350K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: E350K

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: E350K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: E350K

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: E350K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: E350K

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: E166K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: E166K

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184751
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGGAAACCACTACAGGG -3'
(R):5'- GGAAGGCATGATAGCAACCTGC -3'

Sequencing Primer
(F):5'- ACTACAGGGAGAAGCCTCTC -3'
(R):5'- AACCTGCTGACACTGATGG -3'
Posted On2016-12-15