Incidental Mutation 'R5796:Abcd3'
ID447215
Institutional Source Beutler Lab
Gene Symbol Abcd3
Ensembl Gene ENSMUSG00000028127
Gene NameATP-binding cassette, sub-family D (ALD), member 3
SynonymsPMP70, Pxmp1
MMRRC Submission 043387-MU
Accession Numbers

Genbank: NM_008991; MGI: 1349216

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121758774-121815302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121784498 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 160 (R160W)
Ref Sequence ENSEMBL: ENSMUSP00000142387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029770] [ENSMUST00000197383] [ENSMUST00000197662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029770
AA Change: R160W

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029770
Gene: ENSMUSG00000028127
AA Change: R160W

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Pfam:ABC_membrane_2 57 338 8.6e-106 PFAM
AAA 465 640 6.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195965
Predicted Effect probably damaging
Transcript: ENSMUST00000197383
AA Change: R160W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142387
Gene: ENSMUSG00000028127
AA Change: R160W

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ABC_membrane_2 57 277 2.3e-78 PFAM
AAA 355 530 1.1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197662
SMART Domains Protein: ENSMUSP00000143487
Gene: ENSMUSG00000028127

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198169
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show enlarged livers, abnormal bile composition and peroxisome abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Abcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Abcd3 APN 3 121776993 splice site probably benign
IGL00670:Abcd3 APN 3 121775684 missense probably damaging 1.00
IGL02473:Abcd3 APN 3 121769244 missense possibly damaging 0.74
IGL02660:Abcd3 APN 3 121784020 missense probably damaging 1.00
IGL02993:Abcd3 APN 3 121774010 missense probably benign 0.01
IGL03131:Abcd3 APN 3 121781991 splice site probably benign
3-1:Abcd3 UTSW 3 121760300 missense probably benign
R0324:Abcd3 UTSW 3 121769167 missense probably null 0.00
R0599:Abcd3 UTSW 3 121765093 missense probably damaging 1.00
R0682:Abcd3 UTSW 3 121769567 missense possibly damaging 0.90
R1109:Abcd3 UTSW 3 121779596 missense probably damaging 1.00
R1453:Abcd3 UTSW 3 121765061 missense probably damaging 1.00
R1544:Abcd3 UTSW 3 121784473 missense probably benign 0.11
R1571:Abcd3 UTSW 3 121792842 missense possibly damaging 0.80
R1779:Abcd3 UTSW 3 121781963 missense probably damaging 1.00
R2429:Abcd3 UTSW 3 121792863 missense probably damaging 1.00
R4326:Abcd3 UTSW 3 121761470 missense probably benign 0.06
R4676:Abcd3 UTSW 3 121774166 missense possibly damaging 0.69
R4830:Abcd3 UTSW 3 121760284 missense probably damaging 1.00
R4929:Abcd3 UTSW 3 121768746 splice site probably null
R4980:Abcd3 UTSW 3 121769268 splice site probably null
R5052:Abcd3 UTSW 3 121769513 critical splice donor site probably null
R5384:Abcd3 UTSW 3 121761410 splice site probably null
R5616:Abcd3 UTSW 3 121772360 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCGGTGCTAATTGGAGC -3'
(R):5'- ATATGCAATGTGGCCTGAGTTAG -3'

Sequencing Primer
(F):5'- TGCTAATTGGAGCGCACG -3'
(R):5'- TGAGTTAGGAAAATCAGAACTTGTAG -3'
Posted On2016-12-15