Incidental Mutation 'R5796:Fbxo42'
ID447220
Institutional Source Beutler Lab
Gene Symbol Fbxo42
Ensembl Gene ENSMUSG00000028920
Gene NameF-box protein 42
Synonyms6720460I06Rik
MMRRC Submission 043387-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141147913-141204062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141199789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 460 (V460A)
Ref Sequence ENSEMBL: ENSMUSP00000030757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030757]
Predicted Effect probably benign
Transcript: ENSMUST00000030757
AA Change: V460A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030757
Gene: ENSMUSG00000028920
AA Change: V460A

DomainStartEndE-ValueType
FBOX 50 90 2.64e-4 SMART
Pfam:Kelch_5 114 159 7.3e-9 PFAM
Pfam:Kelch_4 118 174 6.1e-10 PFAM
Pfam:Kelch_3 130 182 4e-11 PFAM
Pfam:Kelch_5 228 268 8.2e-10 PFAM
Pfam:Kelch_1 231 274 6.3e-8 PFAM
Pfam:Kelch_2 231 277 5.1e-10 PFAM
Pfam:Kelch_3 241 285 2.9e-8 PFAM
low complexity region 363 376 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 508 513 N/A INTRINSIC
low complexity region 567 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146768
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO42, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (SKP1A; MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Fbxo42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Fbxo42 APN 4 141180449 missense probably damaging 1.00
IGL02331:Fbxo42 APN 4 141167846 missense probably benign 0.08
IGL02989:Fbxo42 APN 4 141199534 missense probably damaging 1.00
IGL03047:Fbxo42 UTSW 4 141199542 missense possibly damaging 0.92
R0158:Fbxo42 UTSW 4 141200329 missense probably benign 0.26
R0295:Fbxo42 UTSW 4 141200497 missense probably damaging 1.00
R0671:Fbxo42 UTSW 4 141195239 missense probably damaging 1.00
R1321:Fbxo42 UTSW 4 141167849 missense probably benign 0.01
R1437:Fbxo42 UTSW 4 141167854 missense probably benign 0.00
R1459:Fbxo42 UTSW 4 141167762 missense probably benign
R1585:Fbxo42 UTSW 4 141198106 splice site probably benign
R1635:Fbxo42 UTSW 4 141200529 missense probably damaging 1.00
R2849:Fbxo42 UTSW 4 141200510 missense probably damaging 1.00
R4288:Fbxo42 UTSW 4 141167896 missense probably damaging 1.00
R4431:Fbxo42 UTSW 4 141200550 missense probably damaging 0.99
R4556:Fbxo42 UTSW 4 141199010 missense probably damaging 1.00
R4701:Fbxo42 UTSW 4 141199809 missense probably benign 0.00
R5071:Fbxo42 UTSW 4 141198945 missense probably damaging 1.00
R5072:Fbxo42 UTSW 4 141198945 missense probably damaging 1.00
R5249:Fbxo42 UTSW 4 141199024 missense probably damaging 1.00
R6366:Fbxo42 UTSW 4 141199949 missense probably benign 0.01
R7197:Fbxo42 UTSW 4 141200085 missense probably benign
R7339:Fbxo42 UTSW 4 141200144 missense possibly damaging 0.95
R7468:Fbxo42 UTSW 4 141199606 missense possibly damaging 0.95
R7605:Fbxo42 UTSW 4 141199818 missense probably benign
R7619:Fbxo42 UTSW 4 141200362 missense possibly damaging 0.69
R7780:Fbxo42 UTSW 4 141193820 critical splice donor site probably null
X0063:Fbxo42 UTSW 4 141195281 missense probably benign 0.00
Z1176:Fbxo42 UTSW 4 141180534 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGAGACCCGAGAGTAC -3'
(R):5'- TCCACGTGACTACTACTGGAAG -3'

Sequencing Primer
(F):5'- ACGAAGCGCCCTGTGTTAATG -3'
(R):5'- CGTGACTACTACTGGAAGCAGAC -3'
Posted On2016-12-15