Mutagenetix > Incidental Mutations

Incidental Mutation 'R5796:Robo4'

447236

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

043387-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R5796 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37411674 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 830 (D830V)

Ref Sequence

ENSEMBL: ENSMUSP00000110700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]

Predicted Effect

probably benign
Transcript: ENSMUST00000034643

SMART Domains

Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
IGc2	54	128	9.7e-11	SMART
IGc2	156	221	1.44e-4	SMART
IGc2	248	311	1.89e-13	SMART
IGc2	337	409	9.84e-12	SMART
IGc2	441	506	2.09e-15	SMART
FN3	534	616	4.24e-14	SMART
FN3	648	731	3.06e0	SMART
FN3	747	832	1.97e-9	SMART
low complexity region	870	890	N/A	INTRINSIC
low complexity region	1055	1082	N/A	INTRINSIC
low complexity region	1131	1149	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC
low complexity region	1193	1206	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1336	1376	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102895
AA Change: D934V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: D934V

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115038

SMART Domains

Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
IGc2	76	150	9.7e-11	SMART
IGc2	178	243	1.44e-4	SMART
IGc2	270	333	1.89e-13	SMART
IGc2	359	431	9.84e-12	SMART
IGc2	463	528	2.09e-15	SMART
FN3	556	638	4.24e-14	SMART
FN3	670	753	3.06e0	SMART
FN3	769	854	1.97e-9	SMART
low complexity region	892	912	N/A	INTRINSIC
low complexity region	1077	1104	N/A	INTRINSIC
low complexity region	1153	1171	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
low complexity region	1215	1228	N/A	INTRINSIC
low complexity region	1267	1278	N/A	INTRINSIC
low complexity region	1290	1303	N/A	INTRINSIC
low complexity region	1358	1398	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115046
AA Change: D993V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: D993V

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115048
AA Change: D830V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: D830V

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167089

Predicted Effect

probably benign
Transcript: ENSMUST00000170512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171467

Predicted Effect

probably benign
Transcript: ENSMUST00000214185
AA Change: D941V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215777

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

93% (51/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,421,428	T9A	possibly damaging	Het
1700125H20Rik	A	G	11: 85,173,275	T81A	probably null	Het
Abcd3	G	A	3: 121,784,498	R160W	probably damaging	Het
Ap3d1	G	T	10: 80,714,037	T758K	possibly damaging	Het
Ate1	T	C	7: 130,467,268	Y423C	probably damaging	Het
Bsn	C	T	9: 108,126,024	G394D	probably damaging	Het
Cacna1d	T	C	14: 30,066,116	D1599G	probably damaging	Het
Cd33	A	G	7: 43,533,056		probably null	Het
Col12a1	T	C	9: 79,703,829	N154D	possibly damaging	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Cts3	A	T	13: 61,568,703	Y40N	probably damaging	Het
Cyfip2	T	C	11: 46,198,996	N1197D	probably benign	Het
Dclre1b	G	A	3: 103,807,457	Q77*	probably null	Het
Dsc3	T	A	18: 19,971,501	M590L	probably benign	Het
Efcab14	A	T	4: 115,746,583	I153F	probably damaging	Het
Fbxo42	T	C	4: 141,199,789	V460A	probably benign	Het
Fgl1	T	G	8: 41,199,759		probably benign	Het
Gbf1	T	C	19: 46,284,343	S1697P	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm13083	A	G	4: 143,615,208	N69S	probably benign	Het
Gm15056	C	A	8: 20,901,982		probably benign	Het
Gm17409	T	A	2: 58,471,022		probably benign	Het
Gm20730	A	G	6: 43,081,530	L116P	probably damaging	Het
Gm4450	A	T	3: 98,446,852	D110E	probably benign	Het
Grb2	T	G	11: 115,645,872	H184P	probably benign	Het
Hepacam2	G	C	6: 3,466,200		probably null	Het
Igkv4-55	T	A	6: 69,607,448	K60M	possibly damaging	Het
Itfg1	T	A	8: 85,718,893	H603L	probably damaging	Het
Katna1	C	A	10: 7,760,811	D366E	probably damaging	Het
Klk1b26	A	G	7: 44,016,328	Y188C	probably damaging	Het
Ldhd	T	C	8: 111,627,090	T464A	probably benign	Het
Muc5b	T	C	7: 141,857,396	S1360P	unknown	Het
Nckipsd	T	G	9: 108,811,614	V116G	probably benign	Het
Nhsl1	C	T	10: 18,524,250	S374L	probably benign	Het
Oxt	G	A	2: 130,576,613	G48D	probably damaging	Het
Ptprk	C	T	10: 28,383,575	T337I	probably damaging	Het
Rad54b	A	T	4: 11,615,446	D818V	probably benign	Het
Rbpjl	T	C	2: 164,410,248		probably benign	Het
Recql5	T	A	11: 115,927,865		probably benign	Het
Rps6kb1	C	T	11: 86,511,851	G339S	probably benign	Het
Rtel1	G	A	2: 181,340,506	E350K	probably benign	Het
Rtn3	A	G	19: 7,457,467	S368P	possibly damaging	Het
Smad5	A	G	13: 56,723,832	H80R	probably damaging	Het
Sppl2c	T	A	11: 104,187,793	M473K	probably benign	Het
Tbrg1	A	G	9: 37,652,575		probably benign	Het
Tcf7	A	G	11: 52,261,527	I65T	probably benign	Het
Tgm2	T	C	2: 158,118,904	D618G	probably benign	Het
Tuba3b	C	T	6: 145,619,682	T292I	probably damaging	Het
Vmn1r63	G	A	7: 5,803,141	S164L	probably benign	Het
Zfp382	A	G	7: 30,133,349	K142E	probably damaging	Het
Zmym3	G	A	X: 101,415,800	P308L	probably benign	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37402635	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37405640	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37404076	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37403505	nonsense	probably null
R8547:Robo4	UTSW	9	37404378	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37408281	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AACTTACTGTATCCACCTCGGC -3'
(R):5'- ACCTAGGACATACCAATCATTCGG -3'

Sequencing Primer
(F):5'- GTATCCACCTCGGCCCTGC -3'
(R):5'- TTGTAGCTCAGACTGACCTGGAAC -3'

Posted On

2016-12-15