Incidental Mutation 'R5796:Ap3d1'
ID447244
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 043387-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80714037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 758 (T758K)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020420
AA Change: T758K

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: T758K

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTTGTGCAACAGGTCAATGTG -3'
(R):5'- TCTGAAAGTTCCAGGCAAGTG -3'

Sequencing Primer
(F):5'- CAGGTCAATGTGTGGCTATCTACAC -3'
(R):5'- TGGCTCTAAGCTCATAGTCAGGAC -3'
Posted On2016-12-15