Incidental Mutation 'R5796:Sppl2c'
ID447249
Institutional Source Beutler Lab
Gene Symbol Sppl2c
Ensembl Gene ENSMUSG00000049506
Gene Namesignal peptide peptidase 2C
Synonyms
MMRRC Submission 043387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104186327-104191163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104187793 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 473 (M473K)
Ref Sequence ENSEMBL: ENSMUSP00000102613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059448] [ENSMUST00000107000]
Predicted Effect probably benign
Transcript: ENSMUST00000059448
AA Change: M473K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091453
Gene: ENSMUSG00000049506
AA Change: M473K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 1.8e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107000
AA Change: M473K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102613
Gene: ENSMUSG00000049506
AA Change: M473K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 2.3e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Sppl2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Sppl2c APN 11 104186979 missense possibly damaging 0.83
IGL02326:Sppl2c APN 11 104187273 missense probably benign 0.27
IGL02479:Sppl2c APN 11 104186937 missense probably benign
H8786:Sppl2c UTSW 11 104186865 missense probably benign 0.04
R0083:Sppl2c UTSW 11 104186532 missense probably benign 0.00
R1625:Sppl2c UTSW 11 104187169 missense probably damaging 0.98
R1913:Sppl2c UTSW 11 104187889 missense probably benign 0.15
R2037:Sppl2c UTSW 11 104186481 missense probably benign 0.23
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2873:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3009:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3010:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3011:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R4698:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4718:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4841:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R4842:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R5248:Sppl2c UTSW 11 104186581 missense possibly damaging 0.88
R5288:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5300:Sppl2c UTSW 11 104187075 missense possibly damaging 0.52
R5384:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5386:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5427:Sppl2c UTSW 11 104187867 missense probably benign 0.01
R5452:Sppl2c UTSW 11 104187300 missense probably benign
R6112:Sppl2c UTSW 11 104187137 missense probably benign 0.00
R6452:Sppl2c UTSW 11 104188191 missense probably benign 0.01
R6476:Sppl2c UTSW 11 104186769 missense probably benign
R7368:Sppl2c UTSW 11 104187604 missense probably damaging 0.99
R7896:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
R7954:Sppl2c UTSW 11 104188516 utr 3 prime probably null
R7979:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTATGGTAGAAGTGGCATCAGG -3'
(R):5'- AGCAGGAATCTTGGCTCTGC -3'

Sequencing Primer
(F):5'- TCAGGTCCAGCAGATTCTTCAAG -3'
(R):5'- TCCAGAAAAGGGTGAACTCTTG -3'
Posted On2016-12-15