Incidental Mutation 'R5796:Recql5'
ID447251
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 043387-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 115927865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000131578] [ENSMUST00000134208] [ENSMUST00000140174]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134208
SMART Domains Protein: ENSMUSP00000137157
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
Blast:DEXDc 25 96 4e-34 BLAST
HELICc 160 241 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134391
Predicted Effect unknown
Transcript: ENSMUST00000140174
AA Change: I292L
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752
AA Change: I292L

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156776
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Cd33 A G 7: 43,533,056 probably null Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCTCCGTCTTCTCTGAGG -3'
(R):5'- CCGACGTCTATGGCAATCTG -3'

Sequencing Primer
(F):5'- CCAAACTGATCTAAACTAGGGGGTTC -3'
(R):5'- CAATCTGAGGGACTTCTGCCTTAAG -3'
Posted On2016-12-15