Incidental Mutation 'R5796:Dsc3'
ID 447255
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Name desmocollin 3
Synonyms 5430426I24Rik
MMRRC Submission 043387-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5796 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20093987-20135408 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20104558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 590 (M590L)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
AlphaFold P55850
Predicted Effect probably benign
Transcript: ENSMUST00000115848
AA Change: M590L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: M590L

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225110
AA Change: M590L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0906 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,215,077 (GRCm39) T9A possibly damaging Het
Abcd3 G A 3: 121,578,147 (GRCm39) R160W probably damaging Het
Ap3d1 G T 10: 80,549,871 (GRCm39) T758K possibly damaging Het
Ate1 T C 7: 130,068,998 (GRCm39) Y423C probably damaging Het
Bsn C T 9: 108,003,223 (GRCm39) G394D probably damaging Het
Cacna1d T C 14: 29,788,073 (GRCm39) D1599G probably damaging Het
Cd33 A G 7: 43,182,480 (GRCm39) probably null Het
Chct1 A G 11: 85,064,101 (GRCm39) T81A probably null Het
Col12a1 T C 9: 79,611,111 (GRCm39) N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 140,769,118 (GRCm39) probably null Het
Cts3 A T 13: 61,716,517 (GRCm39) Y40N probably damaging Het
Cyfip2 T C 11: 46,089,823 (GRCm39) N1197D probably benign Het
Dclre1b G A 3: 103,714,773 (GRCm39) Q77* probably null Het
Efcab14 A T 4: 115,603,780 (GRCm39) I153F probably damaging Het
Fbxo42 T C 4: 140,927,100 (GRCm39) V460A probably benign Het
Fgl1 T G 8: 41,652,796 (GRCm39) probably benign Het
Gbf1 T C 19: 46,272,782 (GRCm39) S1697P probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm15056 C A 8: 21,391,998 (GRCm39) probably benign Het
Gm17409 T A 2: 58,361,034 (GRCm39) probably benign Het
Gm20730 A G 6: 43,058,464 (GRCm39) L116P probably damaging Het
Grb2 T G 11: 115,536,698 (GRCm39) H184P probably benign Het
Hepacam2 G C 6: 3,466,200 (GRCm39) probably null Het
Hsd3b9 A T 3: 98,354,168 (GRCm39) D110E probably benign Het
Igkv4-55 T A 6: 69,584,432 (GRCm39) K60M possibly damaging Het
Itfg1 T A 8: 86,445,522 (GRCm39) H603L probably damaging Het
Katna1 C A 10: 7,636,575 (GRCm39) D366E probably damaging Het
Klk1b26 A G 7: 43,665,752 (GRCm39) Y188C probably damaging Het
Ldhd T C 8: 112,353,722 (GRCm39) T464A probably benign Het
Muc5b T C 7: 141,411,133 (GRCm39) S1360P unknown Het
Nckipsd T G 9: 108,688,813 (GRCm39) V116G probably benign Het
Nhsl1 C T 10: 18,399,998 (GRCm39) S374L probably benign Het
Oxt G A 2: 130,418,533 (GRCm39) G48D probably damaging Het
Pramel21 A G 4: 143,341,778 (GRCm39) N69S probably benign Het
Ptprk C T 10: 28,259,571 (GRCm39) T337I probably damaging Het
Rad54b A T 4: 11,615,446 (GRCm39) D818V probably benign Het
Rbpjl T C 2: 164,252,168 (GRCm39) probably benign Het
Recql5 T A 11: 115,818,691 (GRCm39) probably benign Het
Robo4 A T 9: 37,322,970 (GRCm39) D830V probably benign Het
Rps6kb1 C T 11: 86,402,677 (GRCm39) G339S probably benign Het
Rtel1 G A 2: 180,982,299 (GRCm39) E350K probably benign Het
Rtn3 A G 19: 7,434,832 (GRCm39) S368P possibly damaging Het
Smad5 A G 13: 56,871,645 (GRCm39) H80R probably damaging Het
Sppl2c T A 11: 104,078,619 (GRCm39) M473K probably benign Het
Tbrg1 A G 9: 37,563,871 (GRCm39) probably benign Het
Tcf7 A G 11: 52,152,354 (GRCm39) I65T probably benign Het
Tgm2 T C 2: 157,960,824 (GRCm39) D618G probably benign Het
Tuba3b C T 6: 145,565,408 (GRCm39) T292I probably damaging Het
Vmn1r63 G A 7: 5,806,140 (GRCm39) S164L probably benign Het
Zfp382 A G 7: 29,832,774 (GRCm39) K142E probably damaging Het
Zmym3 G A X: 100,459,406 (GRCm39) P308L probably benign Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 20,118,688 (GRCm39) missense probably null 1.00
IGL01978:Dsc3 APN 18 20,107,253 (GRCm39) missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20,134,963 (GRCm39) missense probably benign 0.01
IGL02165:Dsc3 APN 18 20,116,709 (GRCm39) missense probably benign 0.06
IGL02543:Dsc3 APN 18 20,098,885 (GRCm39) missense probably benign 0.11
IGL02970:Dsc3 APN 18 20,101,317 (GRCm39) missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 20,107,105 (GRCm39) missense probably benign 0.30
R0133:Dsc3 UTSW 18 20,104,639 (GRCm39) missense probably damaging 0.96
R0304:Dsc3 UTSW 18 20,114,298 (GRCm39) missense probably damaging 1.00
R0360:Dsc3 UTSW 18 20,104,639 (GRCm39) missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 20,122,647 (GRCm39) missense probably damaging 1.00
R0826:Dsc3 UTSW 18 20,114,229 (GRCm39) missense probably damaging 0.99
R1120:Dsc3 UTSW 18 20,120,034 (GRCm39) missense probably benign 0.05
R1491:Dsc3 UTSW 18 20,120,091 (GRCm39) missense probably damaging 0.99
R1667:Dsc3 UTSW 18 20,124,617 (GRCm39) missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 20,099,284 (GRCm39) missense probably damaging 1.00
R1792:Dsc3 UTSW 18 20,120,055 (GRCm39) missense probably damaging 1.00
R1858:Dsc3 UTSW 18 20,098,773 (GRCm39) missense probably damaging 0.97
R1965:Dsc3 UTSW 18 20,113,729 (GRCm39) missense probably damaging 1.00
R1988:Dsc3 UTSW 18 20,098,903 (GRCm39) missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 20,122,737 (GRCm39) missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 20,101,411 (GRCm39) missense probably benign 0.00
R2143:Dsc3 UTSW 18 20,113,743 (GRCm39) missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 20,113,743 (GRCm39) missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 20,098,695 (GRCm39) missense probably damaging 0.99
R3038:Dsc3 UTSW 18 20,124,617 (GRCm39) missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 20,104,565 (GRCm39) missense probably damaging 0.99
R4229:Dsc3 UTSW 18 20,098,878 (GRCm39) missense probably damaging 1.00
R4298:Dsc3 UTSW 18 20,113,811 (GRCm39) missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20,134,922 (GRCm39) missense probably benign 0.30
R4590:Dsc3 UTSW 18 20,122,752 (GRCm39) missense probably damaging 1.00
R4615:Dsc3 UTSW 18 20,104,545 (GRCm39) missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 20,096,598 (GRCm39) missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 20,122,591 (GRCm39) missense probably damaging 1.00
R5916:Dsc3 UTSW 18 20,120,077 (GRCm39) missense probably damaging 1.00
R6022:Dsc3 UTSW 18 20,099,395 (GRCm39) missense probably damaging 0.97
R6233:Dsc3 UTSW 18 20,098,852 (GRCm39) missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 20,099,348 (GRCm39) missense probably benign 0.05
R6971:Dsc3 UTSW 18 20,099,275 (GRCm39) critical splice donor site probably null
R7261:Dsc3 UTSW 18 20,113,814 (GRCm39) nonsense probably null
R7442:Dsc3 UTSW 18 20,114,213 (GRCm39) missense probably damaging 1.00
R7795:Dsc3 UTSW 18 20,099,288 (GRCm39) missense probably damaging 1.00
R8051:Dsc3 UTSW 18 20,114,270 (GRCm39) missense probably damaging 1.00
R8531:Dsc3 UTSW 18 20,114,274 (GRCm39) missense probably damaging 1.00
R8531:Dsc3 UTSW 18 20,101,449 (GRCm39) missense probably benign
R8872:Dsc3 UTSW 18 20,122,679 (GRCm39) missense probably benign 0.02
R8927:Dsc3 UTSW 18 20,107,234 (GRCm39) missense probably benign
R8928:Dsc3 UTSW 18 20,107,234 (GRCm39) missense probably benign
R9140:Dsc3 UTSW 18 20,122,616 (GRCm39) missense probably benign 0.01
R9493:Dsc3 UTSW 18 20,122,752 (GRCm39) nonsense probably null
X0061:Dsc3 UTSW 18 20,122,684 (GRCm39) missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 20,099,372 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCCTCCAATAGTTATTCTGCTG -3'
(R):5'- GCAGGAGCCATCTTAATCTGTAG -3'

Sequencing Primer
(F):5'- CTGCTGTTTCAAATCACATGAATTG -3'
(R):5'- TATGGCATGCTCCAGTAGTCACAAG -3'
Posted On 2016-12-15