Incidental Mutation 'R5797:Cyb5rl'
ID447264
Institutional Source Beutler Lab
Gene Symbol Cyb5rl
Ensembl Gene ENSMUSG00000028621
Gene Namecytochrome b5 reductase-like
Synonyms2810410C14Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107066988-107088268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107084207 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 276 (E276D)
Ref Sequence ENSEMBL: ENSMUSP00000102369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000127916] [ENSMUST00000137269] [ENSMUST00000149453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030364
AA Change: E241D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621
AA Change: E241D

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106756
AA Change: E216D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621
AA Change: E216D

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106758
AA Change: E276D

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621
AA Change: E276D

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127916
Predicted Effect unknown
Transcript: ENSMUST00000137269
AA Change: E141D
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621
AA Change: E141D

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Cyb5rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cyb5rl APN 4 107084296 missense probably benign 0.21
IGL01350:Cyb5rl APN 4 107084212 missense possibly damaging 0.77
IGL02418:Cyb5rl APN 4 107070985 missense probably damaging 1.00
IGL02746:Cyb5rl APN 4 107068639 missense probably benign 0.12
IGL03088:Cyb5rl APN 4 107081028 nonsense probably null
IGL03279:Cyb5rl APN 4 107084128 missense possibly damaging 0.95
R1301:Cyb5rl UTSW 4 107080907 missense probably damaging 1.00
R1731:Cyb5rl UTSW 4 107080913 missense probably damaging 1.00
R2091:Cyb5rl UTSW 4 107071006 missense probably damaging 1.00
R2165:Cyb5rl UTSW 4 107068683 missense probably damaging 1.00
R2504:Cyb5rl UTSW 4 107080945 missense probably benign 0.01
R4223:Cyb5rl UTSW 4 107080988 missense probably damaging 0.97
R4851:Cyb5rl UTSW 4 107084313 missense probably benign 0.39
R4964:Cyb5rl UTSW 4 107069132 intron probably benign
R6575:Cyb5rl UTSW 4 107085353 missense probably benign 0.20
R6688:Cyb5rl UTSW 4 107073905 missense probably damaging 0.99
R6986:Cyb5rl UTSW 4 107070876 missense probably benign 0.18
R7097:Cyb5rl UTSW 4 107087316 missense unknown
R7139:Cyb5rl UTSW 4 107071011 missense probably benign 0.35
R7293:Cyb5rl UTSW 4 107080946 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCCCATGTACTGCAGTGG -3'
(R):5'- TAGGACTCCACTTGCTTGGC -3'

Sequencing Primer
(F):5'- GCAGAAAAGAGCTGGCTAGGTG -3'
(R):5'- GATGACATTTGCCCAAGGTC -3'
Posted On2016-12-15