Incidental Mutation 'R5797:Dmap1'
ID447265
Institutional Source Beutler Lab
Gene Symbol Dmap1
Ensembl Gene ENSMUSG00000009640
Gene NameDNA methyltransferase 1-associated protein 1
Synonyms1500016M21Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117674681-117682273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117675480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 333 (V333E)
Ref Sequence ENSEMBL: ENSMUSP00000099748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]
Predicted Effect probably benign
Transcript: ENSMUST00000037127
SMART Domains Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
EXOIII 145 329 1.17e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102687
AA Change: V333E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640
AA Change: V333E

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
SANT 148 201 3.38e-2 SMART
Pfam:DMAP1 243 404 7.1e-76 PFAM
low complexity region 449 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146384
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Dmap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Dmap1 APN 4 117676396 missense possibly damaging 0.67
IGL01517:Dmap1 APN 4 117676009 missense probably damaging 1.00
IGL02926:Dmap1 APN 4 117681888 missense probably benign 0.01
R0118:Dmap1 UTSW 4 117676483 missense probably damaging 1.00
R1586:Dmap1 UTSW 4 117676122 missense probably damaging 0.98
R2504:Dmap1 UTSW 4 117675298 missense probably damaging 1.00
R2940:Dmap1 UTSW 4 117676005 missense possibly damaging 0.72
R4168:Dmap1 UTSW 4 117681310 missense possibly damaging 0.91
R4723:Dmap1 UTSW 4 117676039 missense probably benign 0.05
R4975:Dmap1 UTSW 4 117681036 missense possibly damaging 0.91
R5905:Dmap1 UTSW 4 117676766 missense probably benign 0.00
R5987:Dmap1 UTSW 4 117680842 critical splice donor site probably null
R6117:Dmap1 UTSW 4 117675535 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATATGCACCAGCTCCTCTGTG -3'
(R):5'- GGCCTAATGCTACAGCTCTAAG -3'

Sequencing Primer
(F):5'- TGGGGGTAGGGCTCAGC -3'
(R):5'- GCCTAATGCTACAGCTCTAAGTCTAG -3'
Posted On2016-12-15